Разное

Характеристика счета 69: Счет 69 «Расчеты по социальному страхованию и обеспечению»

03.07.2021

Содержание

Счет 69 "Расчеты по социальному страхованию и обеспечению"

В этом материале, который продолжает серию публикаций, посвященных новому плану счетов, проведен анализ счета 69 "Расчеты по социальному страхованию и обеспечению" нового плана счетов. Этот комментарий подготовлен Я.В. Соколовым, д.э.н., зам. председателя Межведомственной комиссии по реформированию бухгалтерского учета и отчетности, членом Методологического совета по бухгалтерскому учету при Минфине России, первым Президентом Института профессиональных бухгалтеров России, В.В. Патровым, профессором Санкт-Петербургского государственного университета и Н.Н. Карзаевой, к.э.н., зам. директора аудиторской службы ООО "Балт-Аудит-Эксперт".

Содержание

  • Счет 69 "Расчеты по социальному страхованию и обеспечению"

Счет 69 "Расчеты по социальному страхованию и обеспечению" предназначен для обобщения информации о расчетах по социальному страхованию, пенсионному обеспечению и обязательному медицинскому страхованию работников организации.
К счету 69 "Расчеты по социальному страхованию и обеспечению" могут быть открыты субсчета:
69-1 "Расчеты по социальному страхованию",
69-2 "Расчеты по пенсионному обеспечению",
69-3 "Расчеты по обязательному медицинскому страхованию".
На субсчете 69-1 ""Расчеты по социальному страхованию" учитываются расчеты по социальному страхованию работников организации.
На субсчете 69-2 "Расчеты по пенсионному обеспечению" учитываются расчеты по пенсионному обеспечению работников организации.
На субсчете 69-3 "Расчеты по обязательному медицинскому страхованию" учитываются расчеты по обязательному медицинскому страхованию работников организации.
При наличии у организации расчетов по другим видам социального страхования и обеспечения к счету 69 "Расчеты по социальному страхованию и обеспечению" могут открываться дополнительные субсчета.
Счет 69 "Расчеты по социальному страхованию и обеспечению" кредитуется на суммы платежей на социальное страхование и обеспечение работников, а также обязательное медицинское страхование их, подлежащие перечислению в соответствующие фонды. При этом записи производятся в корреспонденции со:
счетами, на которых отражено начисление оплаты труда, - в части отчислений, производимых за счет организации;
счетом 70 "Расчеты с персоналом по оплате труда" - в части отчислений, производимых за счет работников организации.
Кроме того, по кредиту счета 69 "Расчеты по социальному страхованию и обеспечению" в корреспонденции со счетом прибылей и убытков или расчетов с работниками по прочим операциям (в части расчетов с виновными лицами) отражается начисленная сумма пеней за несвоевременный взнос платежей, а в корреспонденции со счетом 51 "Расчетные счета" - суммы, полученные в случаях превышения соответствующих расходов над платежами.
По дебету счета 69 "Расчеты по социальному страхованию и обеспечению" отражаются перечисленные суммы платежей, а также суммы, выплачиваемые за счет платежей на социальное страхование, пенсионное обеспечение, обязательное медицинское страхование.

По кредиту этого счета показывается задолженность организации перед органами социального страхования и обеспечения граждан. Эта задолженность формируется за счет средств предприятия.

При этом дебетуются счета, на которых отражено начисление оплаты труда или счет 99 "Прибыли и убытки" (в части пеней и штрафов).

Счет 69 "Расчеты по социальному страхованию и обеспечению" обычно имеет кредитовое сальдо, которое означает задолженность организации, а может иметь и дебетовое сальдо, которое означает задолженность органов социального страхования и обеспечения перед предприятием. Дебетовое сальдо обычно возникает по расчетам по социальному страхованию, когда сумма взносов, причитающихся с предприятия, оказывается меньше сумм, выплачиваемых работникам за счет платежей на социальное страхование (пособия по временной нетрудоспособности, пособия по беременности и родам и т.п.)

Аналитический учет по счету 69 "Расчеты по социальному страхованию и обеспечению" ведется в разрезе каждого вида расчетов.

В пояснениях к этому счету сказано, что при наличии у организации расчетов по другим видам социального страхования и обеспечения могут открываться дополнительные субсчета. Примером такого случая может быть субсчет по расчетам на обязательное социальное страхование от несчастных случаев на производстве и профессиональных заболеваний.

Счет 69 "Расчеты по социальному страхованию и обеспечению"

Счет 69 в бухгалтерском учете

Для контроля за начислением и уплатой взносов на социальное страхование и обеспечение утвержден счет 69 в бухгалтерском учете предприятий. Его регистры заполняются на основании данных банковских выписок, ведомостей расчета заработной платы согласно трудовым контрактам и договорам подряда. Накопленная на сч. 69 информация переносится в отчетность для ИФНС и Фонда социального страхования, является базой для составления справок по запросам сотрудников, Пенсионного фонда.

Характеристика счета 69

Особенность регистра в том, что основной поток кредитовых оборотов формируется расчетным путем, исходя из образованного за месяц фонда оплаты физическим лицам за выполнение трудовых обязанностей. Исключением является получение денег от Фонд социального страхования в случае превышения расходов (больничные листы, пособия) над начислением. По дебету счет 69 фиксирует проводки только на основании подтверждающих документов:

  • Банковские выписки;
  • Квитанции Сбербанка – оплата наличными;
  • Больничные листы;
  • Письма, копии платежных поручений контрагентов – при уплате взносов третьими лицами.

Определить, 69 счет – активный или пассивный, помогает рассмотрение начального и конечного сальдо. Так как сущность регистра – контроль расчетов с бюджетом и ФСС, то в любой период возникает переплата или задолженность. То есть остаток может принимать кредитовое или дебетовое значение, а это признак активно-пассивного счета. Счет 69 в балансе предприятия отражается в развернутом виде (ПБУ 4/99 п. 34):

  • Строка 1260 в активе – Прочие оборотные активы;
  • Графа 1550 – Прочие обязательства.

Социальная защита населения, показатели по которой учитывает счет 69, в России образуется из трех составляющих – пенсионное обеспечение, страхование медицинское и социальное. Учет операций ведется отдельно по каждой категории страхования.

Счет 69: субсчета

Расчеты с внебюджетными фондами ведутся отдельно по каждой категории начислений в зависимости от их назначения. Для детализации информации по платежам организуются субсчета 69:

  1. Обязательным взносам присваиваются счета второго порядка:
    1. – расчеты с ФСС по единому страховому сбору в части больничных листов по заболеваниям, беременности и родам, а также пособиям по уходу за детьми;
    2. – Пенсионный Фонд;
    3. – Медицинское страхование;
    4. – начисление и расход средств Фонда социального страхования на травматизм, профессиональные заболевания.
  2. Для добровольных отчислений счет 69 организует субсчета в порядке, определенном учетной политикой организаций. Пример:
    1. – взносы на накопительную часть пенсии согласно заявлению персонала, удерживаемые из заработной платы;
    2. – отчисления работодателем за сотрудников в частные медицинские учреждения.

Счет 69: проводки

По кредиту обязательные отчисления одновременно корреспондируются с теми регистрами, на которые относится заработная плата персонала. Для предприятий, деятельность которых связана с изготовлением продукции, сумма взносов распределяется по затратам:

  • Производственным;
  • Общим;
  • Вспомогательным участкам работ.

В компаниях, оказывающие услуги, корреспонденция счета 69 составляется с 26 «Общехозяйственные расходы». Торговые фирмы относят начисления на 44 «Расходы на продажу».

Внимание! Взносы на заработную плату работников, принимающих участие в создании и модернизации основных средств, учитываются на 08 «Вложения во внеоборотные активы» и 07 «Оборудование к установке». Примеры: строительство зданий, восстановление и доведение до установки оборудования, замена и усовершенствование компьютеров.

Аналитический учет по счету 69

Детализация информации по взаимоотношениям с внебюджетными фондами разбивается на:

  • Взносы, начисленные и уплаченные предприятием, по актам проверки контролирующих учреждений;
  • Пени и штрафы, рассчитанные и уплаченные компанией самостоятельно или выставленные инспекторами учреждений социального страхования и обеспечения.

Такой конкретизацией сведений ограничиваются расчеты по Пенсионному и Медицинскому страхованиям (регистры 2 и 3 субсчета 69).

По Фонду социального страхования добавляются данные о произведенных выплатах по больничным листам и пособиям:

  • Болезни и «детские» пособия счет 69. 1 учитывает по графе «Расходы средств ФСС по заболеваниям, материнству и родам»;
  • Компенсации по профессиональным заболеваниям, несчастным случаям на работе, произошедшим по вине компании-работодателя отражает параграф «Расходы на обязательное социальное страхование от несчастных случаев на производстве и профессиональных заболеваний" (счет 69. 11).

Государственная дотация перечисляется Фондом в банковское учреждение после проведения проверки представленного пакета документации согласно принятому реестру:

  • Больничные листы;
  • Заявления сотрудников;
  • Приказы;
  • Расчет пособий, отнесенный на счет 69 в бухгалтерском учете.

Внимание! Первые три дня, указанные в больничном листе, оплачивает работодатель.   Исключение – производственная травма.

Вывод. Синтетический учет счета 69 необходимо вести в развернутом виде для аудита начислений от фонда заработной платы и задолженности по взносам. Детальную информацию о происхождении сумм, сосредоточенных по дебету и кредиту, показывает анализ счета 69.

Счет 69 Расчеты по социальному страхованию и обеспечению Раздела 6. Плана счетов бухгалтерского учета РБ

Счет 69 "Расчеты по социальному страхованию и обеспечению" предназначен для обобщения информации о расчетах по социальному страхованию и обеспечению, в том числе пенсионному, работников.

Отчисления на социальное страхование и обеспечение, производимые за счет организации, отражаются по дебету тех счетов, на которых отражается начисление затрат на оплату труда и других выплат работникам, и кредиту счета 69 "Расчеты по социальному страхованию и обеспечению".

(часть вторая п. 54 в ред. постановления Минфина от 20. 12.2012 N 77)

Производимые за счет работников отчисления на социальное страхование и обеспечение отражаются по дебету счета 70 "Расчеты с персоналом по оплате труда" и кредиту счета 69 "Расчеты по социальному страхованию и обеспечению".

Причитающиеся к уплате штрафы, пени по расчетам по социальному страхованию и обеспечению отражаются по дебету счета 90 "Доходы и расходы по текущей деятельности" и кредиту счета 69 "Расчеты по социальному страхованию и обеспечению".

Уплата отчислений на социальное страхование и обеспечение работников, а также выплаты работникам за счет средств социального страхования отражаются по дебету счета 69 "Расчеты по социальному страхованию и обеспечению" и кредиту счетов 50 "Касса", 51 "Расчетные счета" и других счетов.

Суммы денежных средств, полученные организацией из Фонда социальной защиты населения Министерства труда и социальной защиты Республики Беларусь (далее - Фонд социальной защиты населения), отражаются по дебету счета 51 "Расчетные счета" и кредиту счета 69 "Расчеты по социальному страхованию и обеспечению".

Счет 69 "Расчеты по социальному страхованию и обеспечению" имеет следующие субсчета:

Счет 69 "Расчеты по социальному страхованию и обеспечению" корреспондирует со счетами:

Другие счета раздела 6


Счет 60. Расчеты с поставщиками и подрядчиками Счет 62. Расчеты с покупателями и заказчиками Счет 63. Резервы по сомнительным долгам Счет 65. Отложенные налоговые обязательства Счет 66. Расчеты по краткосрочным кредитам и займам Счет 67. Расчеты по долгосрочным кредитам и займам Счет 68. Расчеты по налогам и сборам Счет 69. Расчеты по социальному страхованию и обеспечению Счет 70. Расчеты с персоналом по оплате труда Счет 71. Расчеты с подотчетными лицами Счет 73. Расчеты с персоналом по прочим операциям Счет 75. Расчеты с учредителями Счет 76. Расчеты с разными дебиторами и кредиторами Счет 77. Расчеты по прямому страхованию и перестрахованию Счет 79. Внутрихозяйственные расчеты

17. Учет расчетов по социальному страхованию и обеспечению

17. Учет расчетов по социальному страхованию и обеспечению

Для создания специальных фондов производятся соответствующие отчисления на социальные нужды, включающиеся в издержки производства или обращения. Пособия по временной нетрудоспособности, санаторно-курортное лечение обеспечиваются отчислениями в фонд социального страхования. Отчисления производятся в Пенсионный фонд. Для обеспечения гражданам равных возможностей в получении медицинской помощи – в фонд ОМС. Для обеспечения временно неработающих – в фонд занятости.

Для этих целей используется счет 69 «Расчеты по социальному страхованию и обеспечению».

При начислении делается запись:

Дебет счета 20 «Основное производство», 23 «Вспомогательное производство», 25 «Общепроизводственные расходы», 26 «Общехозяйственные расходы»,

Кредит счета 69 «Расчеты по социальному страхованию».

Использование средств фонда отражается так: Дебет счета 69 «Расчеты по социальному страхованию»,

Кредит счета 70 «Расчеты с персоналом по оплате труда». Расчеты по пенсионному обеспечению

Отчисления производятся в ПФ РФ. Тариф: для работодателей – 28 % от фонда начисленной зарплаты, для работодателей в сельском хозяйстве, – 20,6 % от фонда, для граждан, занимающихся частной практикой – 28 %, для крестьянских, фермерских хозяйств – 20,6 %, но если они используют наемный труд, то страховые взносы – 28 % от выплат, начисленных в пользу наемных работников.

На счете 69 «Расчеты по социальному страхованию», субсчете 3 учитывается медицинское страхование.

При начислении делается следующая запись:

Дебет счета 20 «Основное производство», 23 «Вспомогательное производство», 25 «Общепроизводственные расходы», 26 «Общехозяйственные расходы», 44 «Расходы на продажу»,

Кредит счета 69 «Расчеты по социальному страхованию».

При начислении средств:

Дебет счета 69«Расчеты по социальному страхованию», Кредит счета 51 «Расчетный счет».

При начислении взносов:

Дебет счета 20 «Основное производство», 23 «Вспомогательное производство», 25 «Общепроизводственные расходы», 26 «Общехозяйственные расходы», 44 «Расходы на продажу»,

Кредит счета 69 «Расчеты по социальному страхованию», субсчет 4 «Расчеты по фонду занятости».

При перечислении средств:

Дебет счета 69 «Расчеты по социальному страхованию», субсчет 4 «Расчеты по фонду занятости»,

Кредит счета 51 «Расчетный счет».

Данный текст является ознакомительным фрагментом.

Продолжение на ЛитРес

Учет расчетов по страхованию и обеспечению.

Основные нормативные документы: Налоговый кодекс РФ,ФЗ «о бух учете», ФЗ «об обязательном пенсионном страховании в РФ», ФЗ «об обеспечении пособиями по временной нетрудоспособности,по беременности и родам,подлежащих обязатльному соц.страхованю» Приказ МИНФИН РФ «об утверждениидекларации по страховым взносам на обязательное пенсионное страхование лиц,производящих выплаты физ.лицам,и порядка ее заполнения»Инструкция о составе фонда зп и выплат соц зарактера» ЕСН – предназначен для мобилизации средств,необходимых для реализации права граждан на гос.пенсионное и социальное обеспечение и мед помощь.Установлена регрессивная ставка,максимально 26%, по взносам на страхование по несчастн случаям на произв. И проф заболеваний есть спец ставка в зависимости от производства и проф направ. предпрятия.Для обобщения инфы ор асчетах предприятия по соц страх,пенс обесп, мед страх предназначен Счет 69 «Расчеты по социальному страхованию и обеспечению» предназначен для обобщения информации о расчетах по социальному страхованию, пенсионному обеспечению и обязательному медицинскому страхованию работников организации.К счету 69 «Расчеты по социальному страхованию и обеспечению» могут быть открыты субсчета: 69–1 «Расчеты по социальному страхованию», 69–2 «Расчеты по пенсионному обеспечению», 69–3 «Расчеты по обязательному медицинскому страхованию». На субсчете 69–1 ""Расчеты по социальному страхованию" учитываются расчеты по социальному страхованию работников организации. На субсчете 69–2 «Расчеты по пенсионному обеспечению» учитываются расчеты по пенсионному обеспечению работников организации. На субсчете 69–3 «Расчеты по обязательному медицинскому страхованию» учитываются расчеты по обязательному медицинскому страхованию работников организации. При наличии у организации расчетов по другим видам социального страхования и обеспечения к счету 69 «Расчеты по социальному страхованию и обеспечению» могут открываться дополнительные субсчета.Счет 69 «Расчеты по социальному страхованию и обеспечению» кредитуется на суммы платежей на социальное страхование и обеспечение работников, а также обязательное медицинское страхование их, подлежащие перечислению в соответствующие фонды. При этом записи производятся в корреспонденции со: счетами, на которых отражено начисление оплаты труда,— в части отчислений, производимых за счет организации; счетом 70 «Расчеты с персоналом по оплате труда» — в части отчислений, производимых за счет работников организации. Кроме того, по кредиту счета 69 «Расчеты по социальному страхованию и обеспечению» в корреспонденции со счетом прибылей и убытков или расчетов с работниками по прочим операциям (в части расчетов с виновными лицами) отражается начисленная сумма пеней за несвоевременный взнос платежей, а в корреспонденции со счетом 51 «Расчетные счета» — суммы, полученные в случаях превышения соответствующих расходов над платежами. По дебету счета 69 «Расчеты по социальному страхованию и обеспечению» отражаются перечисленные суммы платежей, а также суммы, выплачиваемые за счет платежей на социальное страхование, пенсионное обеспечение, обязательное медицинское страхование.По кредиту 69 отражается начиснение ЕСН в корреспонденции со счетами,на кот отражено начиление оплаты труда. Д(20 «Основное производство», 23 Вспомогательные производства, 25 Общепроизводственные расходы, 26 Общехозяйственные расходы, 28 Брак в производстве, 29 Обслуживающие производства и хозяйства,44 Расходы на продажу, 51 Расчетные счета, 52 Валютные счет, 70 Расчеты с персоналом по оплате труда, 73 Расчеты с персоналом по прочим операциям, 91 Прочие доходы и расходы, 96 Резервы предстоящих расходов, 97 Расходы будущих периодов,99 Прибыли и убытки) и К69. По дебту счета отражаются пособия начисленные по соц страхованию в корреспонденции со счетом 70 «расчеты с персоналом по оплате труда». Д69 и К(50 Касса 51 Расчетные счета 52 Валютные счета, 55 Специальные счета в банках, 70 Расчеты с персоналом по оплате труда. )

Консультации

Вопрос:
Описание ситуации.
Банк запускает депозитный продукт сроками на 91 и 360 дней с условием досрочной выплаты процентов за весь срок вперед на следующий день за привлечением денежных средств во вклад (депозит) от клиентов – физических лиц.
Условием депозитной программы предусмотрено полное досрочное расторжение вклада с пересчетом процентов по ставке «До востребования». Излишне уплаченные проценты удерживаются из суммы вклада (депозита) физического лица.
Для учета досрочно выплаченных процентов Клиентам – физическим лицам с последующим отнесением на расходы сумм процентов в течение срока действия вклада, а так же при досрочном расторжении договора вклада Банк формирует следующие бухгалтерские записи.
Вариант 1.
1. Если условиями договора на привлечение денежных средств, предусмотрена досрочная уплата процентов за весь срок нахождения денежных средств, то в день, следующий за размещением денежных средств, вся причитающаяся сумма процентов к уплате без нарушения сроков отображается в учете следующим образом:
Дт 47468 «Расчеты по процентам по банковским счетам и привлеченным средствам физических лиц»
Кт  47411 «Начисленные проценты по банковским счетам и привлеченным средствам физических лиц»
И уплата процентов
Дт 47411 «Начисленные проценты по банковским счетам и привлеченным средствам физических лиц»
Кт 20202 «Касса кредитной организации» или 40817 «Физические лица» или 40820 «Физические лица - нерезидента» или 42301 «Депозиты физических лиц до востребования» или 30102 «Корреспондентские счета кредитных организаций в Банке России»
2. В последний рабочий день месяца (день за который формируется баланс банка) на балансовом счете по учету расходов отражаются все процентные расходы по финансовому обязательству за истекший месяц, в том числе за оставшиеся нерабочие дни, если последний рабочий день месяца не совпадает с его окончанием, либо за период с даты первоначального признания финансового обязательства или с даты начала очередного процентного периода:
Дт 70606 «Расходы» по символам: 31601 «Процентные расходы по депозитам клиентов — физических лиц граждан Российской Федерации» Или 31602 «Процентные расходы по депозитам клиентов — физических лиц нерезидентов»
Кт 47468 «Расчеты по процентам по банковским счетам и привлеченным средствам физических лиц»
3. В случаях, когда срочный вклад, возвращается вкладчику по его требованию до истечения срока либо до наступления иных обстоятельств, указанных в договоре банковского вклада, проценты по вкладу выплачиваются в размере, соответствующем размеру процентов, выплачиваемых банком по вкладам до востребования. Возврат процентов по вкладу при досрочном востребовании клиентом денежных средств отображается в учете в следующем порядке.
В дату расторжения вклада производится отнесение на расходы суммы процентов к вкладу при досрочном расторжении договора по ставке «До востребования» за неполный месяц в день расторжения договора.
Дт 70606 «Расходы» по символам: 31601 «Процентные расходы по депозитам клиентов — физических лиц граждан Российской Федерации» или 31602 «Процентные расходы по депозитам клиентов — физических лиц нерезидентов»
Кт 47468 «Расчеты по процентам по банковским счетам и привлеченным средствам физических лиц»
При досрочном востребовании депозита и пересчете начисленных процентных расходов, при наличии условий в договоре вклада об удержании суммы излишне выплаченных процентов из суммы вклада депозита на сумму, рассчитанную как разность между суммой процентов, рассчитанных по ставке, соответствующей первоначальным условиям договора, и суммой процентов рассчитанных и подлежащих уплате в соответствии с условиями досрочного расторжения договора, осуществляются следующие бухгалтерские записи по списанию излишне начисленных процентов:
Производится удержание излишне уплаченных процентов из суммы вклада, в сумме остатка денежных средств на балансовом счете расчетов по процентам по банковским счетам и привлеченным средствам физических лиц
Дт 423 «Депозиты и прочие привлеченные средства физических лиц»
Или
Дт 426 «Депозиты и прочие привлеченные средства физических лиц — нерезидентов»
Кт 47468 «Расчеты по процентам по банковским счетам и привлеченным и привлеченным средствам физических лиц»
Оставшаяся сумма процентов, причитающаяся к возврату из суммы вклада, отражается в операционных доходах текущего года
Дт 423 «Депозиты и прочие привлеченные средства физических лиц»
Или
Дт 426 «Депозиты и прочие привлеченные средства физических лиц — нерезидентов»
Кт 70601810 «Доходы» по символам 24401 «Операционные доходы по привлеченным депозитам клиентов — физических лиц граждан Российской Федерации»  или 24402 «Операционные доходы по привлеченным депозитам клиентов — физических лиц нерезидентов».

Вариант 2.
1. Если условиями договора на привлечение денежных средств, предусмотрена досрочная уплата процентов за весь срок нахождения денежных средств, то в день, следующий за размещением денежных средств, вся причитающаяся сумма процентов к уплате без нарушения сроков отображается в учете следующим образом (уплата процентов):
Дт 47468 «Расчеты по процентам по банковским счетам и привлеченным и привлеченным средствам физических лиц»
Кт 20202 «Касса кредитной организации» или 40817 «Физические лица» или 40820 «Физические лица - нерезидента» или 42301 «Депозиты физических лиц до востребования» или 30102 «Корреспондентские счета кредитных организаций в Банке России»;
2. В последний рабочий день месяца (день за который формируется баланс банка) на балансовом счете по учету расходов отражаются все процентные расходы по финансовому обязательству за истекший месяц, в том числе за оставшиеся нерабочие дни, если последний рабочий день месяца не совпадает с его окончанием, либо за период с даты первоначального признания финансового обязательства или с даты начала очередного процентного периода:
Дт 70606 «Расходы» по символам:31601 «Процентные расходы по депозитам клиентов — физических лиц граждан Российской Федерации» Или 31602 «Процентные расходы по депозитам клиентов — физических лиц нерезидентов»
Кт  47411 «Начисленные проценты по банковским счетам и привлеченным средствам физических лиц»
И одновременно списание суммы начисленных процентов со счета учета досрочной выплаты
Дт  47411 «Начисленные проценты по банковским счетам и привлеченным средствам физических лиц»
Кт 47468 «Расчеты по процентам по банковским счетам и привлеченным средствам физических лиц»
3. В случаях, когда срочный вклад, возвращается вкладчику по его требованию до истечения срока либо до наступления иных обстоятельств, указанных в договоре банковского вклада, проценты по вкладу выплачиваются в размере, соответствующем размеру процентов, выплачиваемых банком по вкладам до востребования. Возврат процентов по вкладу при досрочном востребовании клиентом денежных средств отображается в учете в следующем порядке.
В дату расторжения вклада производится отнесение на расходы суммы процентов к вкладу при досрочном расторжении договора по ставке «До востребования» за неполный месяц в день расторжения договора.
Дт 70606 «Расходы» по символам: 31601 «Процентные расходы по депозитам клиентов — физических лиц граждан Российской Федерации» или 31602 «Процентные расходы по депозитам клиентов — физических лиц нерезидентов»
Кт  47411 «Начисленные проценты по банковским счетам и привлеченным средствам физических лиц»
И одновременно списание суммы начисленных процентов со счета учета досрочной выплаты
Дт  47411 «Начисленные проценты по банковским счетам и привлеченным средствам физических лиц»
Кт 47468 «Расчеты по процентам по банковским счетам и привлеченным средствам физических лиц».
При досрочном востребовании депозита и пересчета начисленных процентных расходов, при наличии условий в договоре вклада об удержании суммы излишне выплаченных процентов из суммы вклада депозита на сумму, рассчитанную как разность между суммой процентов, рассчитанных по ставке, соответствующей первоначальным условиям договора, и суммой процентов рассчитанных и подлежащих уплате в соответствии с условиями досрочного расторжения договора, осуществляются следующие бухгалтерские записи по списанию излишне начисленных процентов:
Производится удержание излишне уплаченных процентов из суммы вклада, в сумме остатка денежных средств на балансовом счете расчетов по процентам по банковским счетам и привлеченным средствам физических лиц
Дт 423 «Депозиты и прочие привлеченные средства физических лиц» или  426 «Депозиты и прочие привлеченные средства физических лиц — нерезидентов»
Кт 47468 «Расчеты по процентам по банковским счетам и привлеченным средствам физических лиц»
Оставшаяся сумма процентов, причитающаяся к возврату из суммы вклада, отражается в операционных доходах текущего года
Дт 423 «Депозиты и прочие привлеченные средства физических лиц» или 426 «Депозиты и прочие привлеченные средства физических лиц — нерезидентов»
Кт 70601810 «Доходы» по символам 24401 «Операционные доходы по привлеченным депозитам клиентов — физических лиц граждан Российской Федерации» или 24402 «Операционные доходы по привлеченным депозитам клиентов — физических лиц нерезидентов».

Вопрос.
Правильно ли банк применил бухгалтерские записи для учета досрочно выплаченных процентов Клиентам – физическим лицам с последующим равномерным отнесением на расходы сумм процентов в течение срока действия вклада, а так же при досрочном расторжении договора вклада?

клинических характеристик 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 г., в Ухане, Китай | Реанимационная медицина | JAMA

Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 (2019-nCoV) (NCIP), в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов требовали госпитализации в отделение интенсивной терапии и 4 пациента.3% умерли. Предполагаемая передача 2019-nCoV от человека человеку в больнице подозревалась у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой передачей в больнице, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличивалось, но информация о клинических характеристиках больных ограничена.

Цель Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, обстановка и участники Ретроспективная одноцентровая серия случаев 138 последовательных госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г .; окончательная дата наблюдения - 3 февраля 2020 г.

Открытия Документировано NCIP.

Основные результаты и мероприятия Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, радиологические и лечебные данные. Сравнивались исходы пациентов в критическом и некритическом состоянии. Предполагаемая передача в больнице подозревалась, если заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и можно было отследить возможный источник инфекции.

Результаты Из 138 госпитализированных пациентов с NCIP средний возраст составлял 56 лет (межквартильный размах, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Связанная с больницей передача подозревалась как предполагаемый механизм инфекции для затронутых медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали жар (136 [98,6%]), усталость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов 0,8 × 10 9 / л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), увеличенное протромбиновое время (13,0 секунды [IQR, 12,3-13,7]) - у 80 пациентов (58%) и повышенное содержание лактатдегидрогеназы (261 Ед / л [IQR, 182- 403]) у 55 пациентов (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или матовое стекло в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%], цефтриаксон, 34 [24,6%], азитромицин, 25 [18.1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение интенсивной терапии (ОИТ) из-за осложнений, включая синдром острого респираторного дистресс-синдрома (22 [61,1%]), аритмию (16 [44,4%]) и шок (11 [30,6%]). %]). Среднее время от появления первых симптомов до одышки составляло 5,0 дней, до госпитализации - 7,0 дней и до ОРДС - 8,0 дней. Пациенты, проходившие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не проходившими лечение в отделении интенсивной терапии (n = 102), были старше (средний возраст 66 лет против 51 года), с большей вероятностью имели сопутствующие заболевания (26 [72.2%] против 38 [37,3%]), и у них чаще была одышка (23 [63,9%] против 20 [19,6%]) и анорексия (24 [66,7%] против 31 [30,4%]). Из 36 пациентов в отделении интенсивной терапии 4 (11,1%) получали высокопоточную кислородную терапию, 15 (41,7%) получали неинвазивную вентиляцию и 17 (47,2%) получали инвазивную вентиляцию (4 были переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля 47 пациентов (34,1%) были выписаны и 6 умерли (общая летальность 4,3%), но остальные пациенты все еще госпитализированы. Среди выписанных живыми (n = 47) средняя продолжительность пребывания в больнице составила 10 дней (IQR, 7.0-14,0).

Выводы и значимость В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref ID В декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, ныне известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 года в Китае подтверждено 9692 случая заболевания NCIP. На международном уровне случаи заболевания зарегистрированы в 24 странах и 5 континентах. 6 3 января 2020 года новый коронавирус 2019 года (2019-nCoV) был идентифицирован в образцах жидкости бронхоальвеолярного лаважа от пациента в Ухане и был подтвержден как причина NCIP. 7 Полногеномное секвенирование и филогенетический анализ показали, что 2019-nCoV отличается от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (SARS) и ближневосточным респираторным синдромом (MERS). 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и был отнесен к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было постулировано, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что его распространение среди людей произошло через передачу от диких животных, незаконно продаваемых на оптовом рынке морепродуктов Хуанани. 8

Huang et al. 9 впервые сообщили о 41 случае NCIP, в котором большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Хуанань.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальное или пониженное количество лейкоцитов и рентгенологические признаки пневмонии. В тяжелых случаях может наступить дисфункция органов (например, шок, острый респираторный дистресс-синдром [ОРДС], острое повреждение сердца и острое повреждение почек) и смерть. 9 Впоследствии Чен и др. 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. , и может привести к ОРДС.Однако о различиях в клинических характеристиках тяжелых и нетяжелых случаев не сообщалось. Отчеты о случаях подтвердили передачу NCIP от человека к человеку. 10 , 11 В настоящее время нет эффективных методов лечения или вакцин от NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ICU), с нетяжелыми случаями, которые не получали помощь ICU.

Дизайн исследования и участники

Quiz Ref ID Эта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). Были зачислены все последовательные пациенты с подтвержденным NCIP, госпитализированные в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 г.Устное согласие было получено от пациентов. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из основных больниц третичного уровня обучения и отвечает за лечение для NCIP, назначенное правительством. Всем пациентам с NCIP, включенным в это исследование, был поставлен диагноз в соответствии с временными рекомендациями Всемирной организации здравоохранения. 12 Клинические исходы (т.е. выписки, смертность, продолжительность пребывания) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения реанимации больницы Чжуннань Уханьского университета. Эпидемиологические, клинические, лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм для сбора данных из электронных медицинских карт. Данные были проанализированы обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, кортикостероидную терапию, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, компьютерная томография грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с берлинским определением. 13 Острое повреждение почек было идентифицировано в соответствии с определением «Болезнь почек: улучшение глобальных результатов». 14 Поражение сердца определялось, если уровни сердечных биомаркеров (например, тропонина I) в сыворотке крови превышали верхний референсный предел 99-го перцентиля или если при электрокардиографии и эхокардиографии были обнаружены новые аномалии. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии определялись баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического здоровья. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и поступления в ОИТ.

Предполагаемая передача инфекции в больнице подозревалась, если в течение определенного периода времени заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и возможный источник инфекции можно было отследить.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образцов мазка из горла для извлечения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора с 150 мкл раствора для сохранения вируса, и общую РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторного образца (Zhongzhi, Wuhan, China).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим перемешиванием на вортексе в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об / мин в течение 5 минут. Суспензию использовали для анализа РНК 2019-nCoV с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР). Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и белок нуклеокапсида (N), были одновременно амплифицированы и протестированы в ходе анализа RT-PCR в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3 '. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3 '. Анализ ОТ-ПЦР в реальном времени выполняли с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров для зонда, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ RT-PCR выполняли в следующих условиях: инкубация при 50 ° C в течение 15 минут и 95 ° C в течение 5 минут, 40 циклов денатурации при 94 ° C в течение 15 секунд, а также расширение и сбор сигнала флуоресценции при 55 ° C в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 было определено как положительный результат теста, а значение Ct 40 или более было определено как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http: // ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частота и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианного и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием тестов независимых групп t , когда данные были нормально распределены; в противном случае использовали тест Манна-Уитни.Данные (ненормальное распределение) от повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Пропорции категориальных переменных сравнивались с использованием критерия χ 2 , хотя точный критерий Фишера использовался, когда данные были ограничены. Все статистические анализы были выполнены с использованием программного обеспечения SPSS (Статистический пакет для социальных наук) версии 13.0 (SPSS Inc). Для нескорректированных сравнений двусторонний α менее 0,05 считался статистически значимым. Анализы не корректировались для множественных сравнений, и, учитывая возможность ошибки типа I, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

В исследуемую популяцию вошли 138 госпитализированных пациентов с подтвержденным NCIP. Средний возраст составлял 56 лет (IQR, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Из них 102 (73,9%) были помещены в изоляторы, 36 (26.1%) поступили и переведены в ОИТ из-за развития органной дисфункции (таблица 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составляла 5 дней (IQR, 1-10), 7 дней (IQR, 4-8) и 8 дней (IQR, 6-12), соответственно (Таблица 1 ). Из 138 пациентов 64 (46,4%) имели одно или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее частыми сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), усталость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (Таблица 1). В общей сложности 14 пациентов (10,1%) первоначально поступили с диареей и тошнотой за 1-2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощь в ОИТ (n = 102), пациенты, которым требовалась помощь в ОИТ (n = 36), были значительно старше (средний возраст 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37- 62]; P <.001) и чаще имели сопутствующие заболевания, включая артериальную гипертензию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%])), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярных заболеваний (6 [16,7%] против 1 [1,0%]). По сравнению с пациентами, не получавшими ОИТ, пациенты, поступившие в ОИТ, чаще жаловались на боль в глотке, одышку, головокружение, брюшную полость. боль и анорексия.

Показатели жизнедеятельности и лабораторные параметры у пациентов в отделениях интенсивной терапии и не в отделениях интенсивной терапии

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не различались между пациентами, которые получали помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в больницу для всех пациентов, а затем разделялись на тех, кто позже был помещен в отделение интенсивной терапии или нет. Между пациентами, поступившими в отделение интенсивной терапии, и пациентами, не поступившими в отделение интенсивной терапии, имелись многочисленные различия, включая более высокие уровни лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 включенных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до поступления в ОИТ составляло 10 дней (IQR, 6–12) (Таблица 3).В день поступления в ОИТ - медиана шкалы комы Глазго; Острая физиология и оценка хронического здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9-15), 17 (IQR, 10-22) и 5 ​​(IQR, 3-6), соответственно (Таблица 3). Среднее парциальное давление кислорода составляло 68 мм рт. Ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составляла 136 мм рт. Ст. (IQR, 103–234).

Дисфункции органов и основные вмешательства

Дисфункция органов и лечение 138 пациентов показаны в таблице 4.По состоянию на 3 февраля 2020 года 85 пациентов (61,6%) все еще были госпитализированы. Всего было выписано 47 пациентов (34,1%), 6 пациентов (4,3%) умерли. Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты и 6 умерли. Из 11 пациентов, оставшихся в отделении интенсивной терапии, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​- на неинвазивную вентиляцию легких). Среди 138 пациентов частыми осложнениями были шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмии (23 [16,7%]) и острого сердечного повреждения (10 [7,2%]). Пациенты, которые получали лечение в отделении интенсивной терапии, имели больше шансов иметь одно из этих осложнений, чем пациенты, не находящиеся в отделении интенсивной терапии.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород, а 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная механическая вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых получали экстракорпоральную мембранную оксигенацию в качестве неотложной терапии. В общей сложности 13 пациентов получали вазопрессоры, а 2 пациента получали заместительную почечную терапию.

Динамический профиль лабораторных данных у пациентов с NCIP

Для определения основных клинических признаков, которые проявлялись во время прогрессирования NCIP, динамические изменения 6 клинических лабораторных параметров, включая гематологические и биохимические параметры, отслеживались с 1 по 19 день после начала заболевания с двухдневными интервалами.В конце 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов наблюдалась выраженная лимфопения, а у не выживших со временем развивалась более тяжелая лимфопения. Количество лейкоцитов и нейтрофилов у не выживших было выше, чем у выживших. Уровень D-димера был выше у выживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического статуса уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая передача и инфекция в больнице

Из 138 пациентов 57 (41,3%) предположительно были инфицированы в больнице, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 - из терапевтического и 5 - из онкологического.Из инфицированных медицинских работников 31 (77,5%) работали в палатах общего профиля, 7 (17,5%) - в отделении неотложной помощи и 2 (5%) - в отделении интенсивной терапии. У одного пациента в текущем исследовании появились абдоминальные симптомы, и он был госпитализирован в хирургическое отделение. Предположительно, более 10 медицинских работников этого отделения заразились этим пациентом. Также предполагалось, что произошла передача инфекции от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одной палате были инфицированы, и все они имели атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем пациент был изолирован. Впоследствии у других 3 пациентов в том же отделении поднялась температура, появились абдоминальные симптомы, и им был поставлен диагноз инфекции nCoV.

Quiz Ref ID Этот отчет, насколько нам известно, представляет собой крупнейшую на сегодняшний день серию случаев госпитализированных пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% были выписаны, 6 умерли (4,3%), 61,6% остаются госпитализированными. Для выписанных (n = 47) пребывание в стационаре составило 10 дней (IQR, 7,0–14,0). Время от появления одышки составляло 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Обычными симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально наблюдались атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачность матового стекла были типичным признаком компьютерной томографии для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась кислородная терапия, а меньшинство пациентов нуждались в инвазивной вентиляции или даже экстракорпоральной мембранной оксигенации.

Quiz Ref ID Данные этого исследования свидетельствуют о возможности быстрой передачи вируса 2019-nCoV от человека к человеку. Основная причина заключается в оценке основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется на новых людей, она воспроизводится; R 0 указывает среднее количество дополнительных лиц, которых заражает один больной в течение его болезни, и конкретно относится к группе людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что означает, что в среднем от каждого пациента инфекция передается двум.2 других человека. 15 Одна из причин быстрого распространения может быть связана с атипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что нКоВ был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако трудно дифференцировать и обследовать пациентов с атипичными симптомами. Тем не менее, быстрая передача от человека к человеку среди близких контактов является важной особенностью пневмонии nCoV. 10 , 11,15

Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не получавшими ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение заключается в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками-мужчинами.По сравнению с симптомами у пациентов, не находящихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам определить пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому что случаи в предыдущем исследовании относились к ранней эпидемической стадии NCIP, а текущие случаи - из стадия вспышки.

Наиболее частыми лабораторными отклонениями, наблюдаемыми в этом исследовании, были пониженное количество лимфоцитов, увеличенное протромбиновое время и повышенная лактатдегидрогеназа. По сравнению с пациентами, не входящими в ОИТ, пациенты, которые получали лечение в ОИТ, имели многочисленные лабораторные отклонения. Эти отклонения предполагают, что инфекция 2019-nCoV может быть связана с клеточным иммунодефицитом, активацией коагуляции, повреждением миокарда, повреждением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией БВРС-КоВ и ТОРС-КоВ.

Динамический профиль лабораторных данных отслеживался у 33 пациентов с NCIP (5 выживших и 28 выживших). У не выживших количество нейтрофилов, D-димер, уровни мочевины в крови и креатинина продолжали расти, а количество лимфоцитов продолжало снижаться до наступления смерти. Нейтрофилия может быть связана с цитокиновым штормом, вызванным вирусной инвазией, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref ID До настоящего времени не рекомендовалось никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этой болезни заключается в борьбе с источником инфекции; использование мер индивидуальной защиты для снижения риска передачи; и ранняя диагностика, изоляция и поддерживающее лечение пораженных пациентов. Антибактериальные средства неэффективны.Кроме того, не было обнаружено, что противовирусные агенты приносят пользу при лечении SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировалась в зависимости от тяжести заболевания. Однако никаких эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы дыхательных путей были использованы для диагностики NCIP с помощью RT-PCR.Сыворотка пациентов для оценки виремии не бралась. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, передача / инфекция в больницах не могла быть окончательно доказана, но предполагалась и предполагалась на основании времени и характера контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, из 138 случаев большинство пациентов все еще госпитализированы на момент подачи рукописи.Следовательно, трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением болезни.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, отвечающие за переписку: Чжиюн Пэн, доктор медицины, отделение интенсивной терапии (pengzy5 @ hotmail.com) и Синхуан Ван, доктор медицины, отделение урологии ([email protected]), больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. doi: 10.1001 / jama.2020.1585

Исправление: Эта статья была исправлена ​​20 февраля 2020 г., чтобы добавить правильные данные для пациенток в Таблице 1.

Вклад авторов: Доктора Д.Ван и Пэн имели полный доступ ко всем данным в исследовании и несли ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и имеют первое авторство. Доктора Пэн и X. Ван внесли равный вклад в эту статью.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: Д. Ван, К. Ху, Чжу, Лю, Чжан, Б. Ван, Сян, Чэн, Сюн, Пэн.

Составление рукописи: Д. Ван, Ч. Ху, Сян, Сюн, Ли, Пэн.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Д. Ван, Б. Ху, Чжу, Лю, Чжан, Б. Ван, Ченг, Сюн, Чжао, X. Ван, Пэн.

Статистический анализ: C. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Наблюдение: Б. Ху, Сюн, Чжао, X. Ван, Пэн.

Раскрытие информации о конфликте интересов: Не сообщалось.

Финансирование / поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 доктору Д. Вангу; гранты 81772046 и 81971816 доктору Пэну) и Специальным проектом значительных исследований и разработок новых лекарственных средств в крупных национальных Научно-технические проекты Китая (2020ZX0

07 доктору Пэну).

Роль спонсора / спонсора: Спонсоры не играли никакой роли в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Lu H, Страттон CW, Тан YW. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi: 10.1002 / jmv.25678PubMedGoogle Scholar2.Hui DS, я Азхар Э, Мадани TA, и другие. Сохраняющаяся угроза эпидемии нового коронавируса 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.]. Int J Заразить Дис . 2020; 91: 264-266. DOI: 10.1016 / j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван W, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.]. Ланцет . DOI: 10.1016 / S0140-6736 (20) 30211-7PubMedGoogle Scholar10.Chan JF-W, юань S, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 года]. Ланцет . 2020; S0140-6736 (20) 30154-9. DOI: 10.1016 / S0140-6736 (20) 30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг QC, и другие. Ввоз и передача от человека к человеку нового коронавируса во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMc2001272PubMedGoogle Scholar13.Ranieri В.М., Рубенфельд GD, Томпсон BT, и другие; Рабочая группа по определению ARDS. Синдром острого респираторного дистресс-синдрома: берлинское определение. ЯМА . 2012; 307 (23): 2526-2533. DOI: 10.1001 / jama.2012.5669PubMedGoogle Scholar 14. Заболевание почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Руководство KDIGO по клинической практике при острой травме почек. Почки Интенсивное . 2012; 2: 1.Google ScholarCrossref 15.Ли Q, Гуань X, Wu П, и другие. динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi: 10.1056 / NEJMoa2001316PubMedGoogle Scholar16.Zhang H, Кан ZJ, Гонг Привет, и другие. Пищеварительная система - потенциальный путь заражения нКоВ 2019: биоинформатический анализ, основанный на одноклеточных транскриптомах. Препринт. Опубликовано 31 января 2020 г.bioRxiv 927806. DOI: 10.1101 / 2020.01.30.927806

Репертуар нормальных B-клеток, производных IGHV1-69, содержит стереотипные паттерны, характерные для немутантных CLL | Кровь

Было много попыток найти B-клетки происхождения CLL с использованием фенотипического и иммуногенетического анализов, поиск, который стал еще более сложным, когда 2 подмножества были описаны на основе мутационного статуса генов IGHV. 2,4 Более недавние открытия общих консервативных последовательностей в областях IGV, выраженных в значительной части случаев CLL, по-видимому, отдалили CLL дальше от нормальных B-клеток, потому что подобные последовательности в последних, как сообщалось, были исчезающе редкими. 29,30 Оказалось, что ХЛЛ произошел от В-клеток, управляемых антигеном, без четкого аналога в репертуаре нормальных В-клеток. Однако одна из причин этого заключается в том, что последовательности IGHV в общедоступных базах данных редко происходят от нормальных В-клеток и почти никогда - от наивных В-клеток, что ограничивает сравнительный анализ.

Большинство консервативных (стереотипных) последовательностей обнаруживается в U-CLL, где предвзятое использование генов IGHV вместе с определенными генами IGHD и выбранными сегментами генов IGHJ приводит к сходным последовательностям в определенной доле случаев. 15 Наиболее очевидным примером систематической ошибки при ХЛЛ является аллель 51p1 гена IGHV1-69 , который редко мутирует и составляет 13% всех ХЛЛ и 25-30% U-ХЛЛ. 15 Комбинация с некоторыми генами IGHD, в частности RF, и с IGHJ6 генерирует высококонсервативные стереотипные последовательности схожей длины HCDR3. 15,16,19,31,32 Эти особенности не были отмечены в базе данных нормальных последовательностей B-клеток. 18,19 Были предприняты конкретные попытки найти аналоги в нормальных В-клетках, обычно путем амплификации последовательности 51p1 вместе со смешанными праймерами IGHJ или Cμ.Полученные последовательности HCDR3 были короче, чем последовательности, характерные для CLL, с другим репертуаром использования гена IGHD, что привело к заключению, что клетки CLL отличались от нормальных B-клеток. 30 В нашем собственном исследовании использовалась та же стратегия для изучения использования гена 51p1 у здоровых пожилых людей, и, хотя длина HCDR3, по-видимому, определяла 2 популяции, общий вывод снова заключался в том, что нормальные В-клетки не отражают ХЛЛ. 13 Исключением было небольшое исследование 6 последовательностей, производных 51p1 из нормальных В-клеток, где все они произошли от IGHJ6 и где длины HCDR3 были аналогичны таковым в CLL. 20 Взятые вместе, CLL-подобные последовательности были обнаружены в основном там, где использовался IGHJ6 , и, поскольку они составляют только 28% от 51p1 -производных последовательностей, комбинации с другими генами IGHJ, особенно IGHJ4 , были доминирующими. Анализ. 13

Сейчас мы сосредоточились только на последовательностях, производных от 51p1 , в сочетании с IGHJ6 у здоровых субъектов того же возраста, и сразу становится ясно, что эта большая база данных выявляет аналоги последовательностей CLL.Стереотипные последовательности нескольких основных подмножеств, описанных в CLL, поддаются идентификации, так же как и аналоги новых стереотипов. Кроме того, можно обнаружить стереотипные последовательности, еще не описанные в CLL. Всего 33,3% последовательностей можно было отнести к подмножествам. Это открытие демонстрирует, что консервативные последовательности характерны для этой фракции нормальных В-клеток крови и являются вероятным источником трансформации в U-CLL.

Однако могут существовать многие другие подмножества, отличные от IGHJ6 .Поскольку мы сосредоточились на IGHJ6 , поразительная стереотипная последовательность в CLL, происходящая от гена IGHD3-16 (RF 2) в сочетании с IGHJ3 16 , не была обнаружена и ищется отдельно. В стереотипах CLL, производных IGHJ6 , существует меньшее сходство в этих соединительных аминокислотах между случаями CLL, и эта вариабельность также наблюдалась в нормальных B-клетках. 15,16,19,32 Следует также отметить, что B-клетки, использующие ген IGHV1-69 , обычно мутировавшие, размножаются при других пролиферативных заболеваниях B-клеток, особенно связанных с инфекцией гепатита C. 33-35 Однако они, по-видимому, редко вовлекают IGHJ6 или демонстрируют консервативную последовательность, характерную для CLL. 33-35

Консервативные последовательности в U-CLL могут означать общую активность антител. Аутореактивность была отмечена для производных 51p1 IgM, полученных из случаев ХЛЛ, причем 1 случай ХЛЛ в подгруппе 5 ( IGHV1-69 / IGHD3-10 / IGHJ6 ) реагировал с главными клетками желудка и богатым пролином кислотным белком 1, экспрессируемым апоптотические клетки. 36 IgM из еще 3 случаев ХЛЛ, происходящих из подгруппы 7 ( IGHV1-69 / IGHD3-3 / IGHJ6 ), также связывались с апоптотическими клетками. 37 Хотя аутореактивность является сложной, а полиреактивность обычна для IgM из U-CLL, 38 есть предположение, что IgM из случаев CLL в пределах подмножеств могут распознавать аналогичные цитоплазматические структуры. 38 Возможно, что более важно, по крайней мере один IGHV1-69 -кодируемый CLL-производный IgM распознает полисахарид, полученный из Streptococcus pneumoniae . 36 Если очень похожие IgM из нормальных B-клеток имитируют эту реактивность, это будет подтверждать концепцию, что репертуар консервативных последовательностей генерируется для борьбы с общими патогенами или, возможно, с клиренсом апоптотических клеток.

Ранее предполагалось, что природные антитела составляют врожденный репертуар или «естественную память», способную распознавать обычные бактерии. 39 Сообщалось, что панель из 7 антител IgM против капсульных пневмококковых полисахаридов от здоровых субъектов экспрессирует ряд немутантных генов IGHV, 6 из 7 которых объединены с IGHJ6. 40 Известно, что IgM-антитела против пневмококкового полисахарида вырабатываются переходными В-клетками селезенки посредством неспецифической стимуляции с помощью CpG. 39 Переходные В-клетки человека считаются предшественниками наивных В-клеток и, возможно, В-клеток памяти IgM. Взятые вместе, существует вероятность, что предшественники по крайней мере 51p1 -производной субпопуляции U-CLL могут находиться в этой популяции. Если это так, клетки должны циркулировать, поскольку наш анализ был ограничен кровью.

Фенотипический анализ популяции G6 + , которая будет включать все 51p1 -производные B-клетки, локализовал эти клетки в общепринятой в покое наивной или, возможно, переходной субпопуляции B-клеток. Характеристики отражают характеристики нормальных В-клеток CD23 + / CD27 -, которые составляют примерно 35% от общего количества В-клеток на протяжении всей жизни и включают от 20% до 25% В-клеток CD5 + . 41 Фенотип не полностью соответствует фенотипу клеток CLL, особенно в отношении экспрессии CD5, очевидной только на небольшой части этих нормальных B-клеток.Известно, что экспрессия CD5 модулируется взаимодействием с рецептором В-клеток и у мышей увеличивается в анергических В-клетках, где он контролирует порог передачи сигнала. 42 Регуляция экспрессии CD5 в человеческих В-клетках сложна, но опять-таки на нее влияет вовлечение В-клеточного рецептора и подавляется интерлейкином-6. 43 Возможно, поэтому неудивительно, что экспрессия CD5 в наивных нормальных B-клетках G6 + не совпадает с экспрессией CLL. Эти В-клетки не только трансформируются, но также очевидно взаимодействуют с антигеном. 9 Независимо от происхождения ХЛЛ, нормальные В-клетки со сходными характеристиками в их генах иммуноглобулинов, вероятно, имеют эволюционное прошлое, которое вооружает человеческую популяцию для борьбы с инфекцией. Мы предполагаем, что стимуляция этих В-клеток может вызвать U-CLL, и мы будем искать подтверждения у пациентов с конкретными инфекциями. Вопрос в том, движет ли дальнейшая инфекция опухолевые клетки, и подозрение, что это, вероятно, уже развивается. 44 Наблюдение за тем, что клетки CLL взаимодействуют с антигеном in vivo с последующим подавлением sIgM, предполагает, что присутствует постоянный «антиген». 9 Важно идентифицировать этот антиген и блокировать явно стимулирующее взаимодействие, которое может поддерживать ХЛЛ.

Онлайн-версия этой статьи содержит дополнение с данными.

Расходы на публикацию этой статьи были частично оплачены за счет оплаты страницы. Таким образом, исключительно для того, чтобы указать на этот факт, данная статья помечена как «реклама» в соответствии с разделом 18 USC 1734.

Характеристики SARS-CoV-2 и COVID-19

  • 1.

    Цуй, Дж., Ли, Ф. и Ши, З. Л. Происхождение и эволюция патогенных коронавирусов. Nat. Rev. Microbiol. 17 , 181–192 (2019).

    CAS Google Scholar

  • 2.

    Wu, J. T., Leung, K. & Leung, G. M. Прогнозирование текущей погоды и потенциальное внутреннее и международное распространение вспышки 2019-nCoV, возникшей в Ухане, Китай: модельное исследование. Ланцет 395 , 689–697 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 3.

    Hui, D. S. et al. Сохраняющаяся угроза эпидемии нового коронавируса 2019-nCoV для глобального здравоохранения - последняя вспышка нового коронавируса 2019 года в Ухане, Китай. Intl. J. Infect. Дис. 91 , 264–266 (2020).

    CAS Google Scholar

  • 4.

    Дэн С.К. и Пэн Х.Д. Характеристики и меры общественного здравоохранения в ответ на вспышку коронавирусной болезни 2019 г. в Китае. J. Clin. Med. 9 , 575 (2020).

    PubMed Central Google Scholar

  • 5.

    Хан, К., Линь, К., Джин, С. и Ю, Л. Коронавирус 2019-nCoV: краткий обзор с передовой. J. Infect. 80 , 373–377 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 6.

    Zhu, N. et al. Новый коронавирус от пациентов с пневмонией в Китае, 2019. N. Engl. J. Med. 382 , 727–733 (2020).

    CAS Статья Google Scholar

  • 7.

    Гралински Л. Э. и Менахери В. Д. Возвращение коронавируса: 2019-nCoV. Вирусы 12 , 135 (2020).

    PubMed PubMed Central Google Scholar

  • 8.

    Цзян, С., Ду, Л. и Ши, З. Возникающий коронавирус, вызывающий вспышку пневмонии в Ухане, Китай: призыв к разработке терапевтических и профилактических стратегий. Emerg. Микробы заражают. 9 , 275–277 (2020).

    PubMed PubMed Central Google Scholar

  • 9.

    Ву, З. и МакГуган, Дж. М. Характеристики и важные уроки вспышки коронавирусного заболевания 2019 г. (COVID-19) в Китае: краткое изложение отчета Китайского центра по контролю и профилактике заболеваний о 72314 случаях. JAMA 323 , 1239–1242 (2020).

    CAS Google Scholar

  • 10.

    Wu, F. et al. Новый коронавирус, связанный с респираторным заболеванием человека в Китае. Природа 579 , 265–269 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 11.

    Zhou, P. et al. Вспышка пневмонии, связанная с новым коронавирусом, вероятно, происхождения летучих мышей. Природа 579 , 270–273 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 12.

    Chan, J. F. et al. Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера. Ланцет 395 , 514–523 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 13.

    Chen, N. et al. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование. Ланцет 395 , 507–513 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 14.

    Ван Р., Чжан Х., Ирвин Д. М. и Шен Ю. Появление коронавируса, похожего на атипичную пневмонию, представляет собой новую проблему для Китая. J. Infect. 80 , 350–371 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 15.

    Национальная комиссия здравоохранения Китайской Народной Республики. Брифинг о последней ситуации с эпидемией новой коронавирусной пневмонии. http://www.nhc.gov.cn/xcs/yqtb/list_gzbd.shtml (2020).

  • 16.

    Редакционная группа Eurosurveillance. Примечание редакции: Всемирная организация здравоохранения объявляет новый коронавирус (2019-nCoV) шестой чрезвычайной ситуацией в области общественного здравоохранения, имеющей международное значение. евро. Surveill. 25 , 200131e (2020).

    PubMed Central Google Scholar

  • 17.

    Исследовательская группа Coronaviridae Международного комитета по таксономии вирусов. Коронавирус, связанный с тяжелым острым респираторным синдромом: классификация 2019-nCoV и присвоение ему названия SARS-CoV-2. Nat. Microbiol. 5 , 536–544 (2020).

    Google Scholar

  • 18.

    Фишер Д. и Хейманн Д. Вопросы и ответы: новая вспышка коронавируса, вызывающая COVID-19. BMC Med. 18 , 57 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 19.

    Лай, С.К., Ши, Т.П., Ко, В.К., Тан, Х.Дж. и Сюэ, П.Р. Коронавирус 2 (SARS-CoV-2) и коронавирусная болезнь-2019 (COVID-19), тяжелый острый респираторный синдром: эпидемия и проблемы. Внутр. J. Antimicrob.Агенты 55 , 105924 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 20.

    Всемирная организация здравоохранения. Коронавирусная болезнь 2019 (COVID-19). Отчет о ситуации - 51. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200311-sitrep-51-covid-19.pdf?sfvrsn=1ba62e57_10 (2020).

  • 21.

    Донг, Э., Ду, Х. и Гарднер, Л. Интерактивная веб-панель для отслеживания COVID-19 в режиме реального времени. Lancet Infect. Дис. 20 , 533–534 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 22.

    Li, Q. et al. Динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. N. Engl. J. Med. 382 , 1199–1207 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 23.

    Deslandes, A. et al. SARS-CoV-2 уже распространился во Франции в конце декабря 2019 года. Int. J. Antimicrob. Агенты 55 , 106006 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 24.

    Lu, R. et al. Геномная характеристика и эпидемиология нового коронавируса 2019 года: значение для происхождения вируса и связывания с рецептором. Ланцет 395 , 565–574 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 25.

    Chan, J. F. et al. Геномная характеристика нового патогенного для человека коронавируса 2019 года, выделенного от пациента с атипичной пневмонией после посещения Ухани. Emerg. Микробы заражают. 9 , 221–236 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 26.

    Андерсон, К. Г., Рамбаут, А., Липкин, В. И., Холмс, Э. К. и Гарри, Р. Ф. Проксимальное происхождение SARS-CoV-2. Nat.Med. 26 , 450–452 (2020).

    Google Scholar

  • 27.

    Coutard, B. et al. Спайковый гликопротеин нового коронавируса 2019-nCoV содержит фурин-подобный сайт расщепления, отсутствующий в CoV той же клады. Antiviral Res. 176 , 104742 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 28.

    Zhou, H. et al.Новый коронавирус летучих мышей, тесно связанный с SARS-CoV-2, содержит естественные вставки в сайте расщепления S1 / S2 белка-шипа. Curr. Биол. 30 , 2196–2203 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 29.

    Wrobel, A. G. et al. Шиповые гликопротеиновые структуры SARS-CoV-2 и летучей мыши RaTG13 информируют об эволюции вируса и эффектах расщепления фурином. Nat. Struct. Мол. Биол. 27 , 763–767 (2020).

    CAS Google Scholar

  • 30.

    Su, Y. C. F. et al. Открытие и геномная характеристика 382-нуклеотидной делеции в ORF7b и ORF8 во время ранней эволюции SARS-CoV-2. мБио 11 , e01610-20 (2020).

    PubMed PubMed Central Google Scholar

  • 31.

    Zhao, W. M. et al. Ресурс о новом коронавирусе 2019 года. И Чуань 42 , 212–221 (2020).

    Google Scholar

  • 32.

    Korber, B. et al. Отслеживание изменений в спайке SARS-CoV-2: свидетельство того, что D614G увеличивает инфекционность вируса COVID-19. Ячейка 182 , 812–827 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 33.

    Tang, X. et al. О происхождении и продолжающейся эволюции SARS-CoV-2. Natl Sci. Ред. 7 , 1012–1023 (2020).

    Google Scholar

  • 34.

    Форстер П., Форстер Л., Ренфрю К. и Форстер М. Филогенетический сетевой анализ геномов SARS-CoV-2. Proc. Natl Acad. Sci. США 117 , 9241–9243 (2020).

    CAS Google Scholar

  • 35.

    Paraskevis, D. et al. Полногеномный эволюционный анализ нового вируса короны (2019-nCoV) отвергает гипотезу возникновения в результате недавнего события рекомбинации. Заражение. Genet. Evol. 79 , 104212 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 36.

    Hu, D. et al. Геномная характеристика и инфекционность нового SARS-подобного коронавируса у китайских летучих мышей. Emerg. Микробы заражают. 7 , 154 (2018).

    Google Scholar

  • 37.

    Lau, S. K. P. et al. Возможное происхождение коронавируса тяжелого острого респираторного синдрома от летучих мышей 2. Emerg. Заразить. Дис. 26 , 1542–1547 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 38.

    Чжан Ю. З. и Холмс Э. С. Геномный взгляд на происхождение и возникновение SARS-CoV-2. Ячейка 181 , 223–227 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 39.

    Лам Т.T. et al. Выявление коронавирусов, связанных с SARS-CoV-2, у малайских панголинов. Природа 583 , 282–285 (2020).

    CAS Google Scholar

  • 40.

    Xiao, K. et al. Изоляция коронавируса, связанного с SARS-CoV-2, от малайских ящеров. Природа 583 , 286–289 (2020).

    CAS Google Scholar

  • 41.

    Лю П., Чен В.И Чен, Дж. П. Вирусная метагеномика выявила вирус Сендай и коронавирусную инфекцию малайских панголинов (Manis javanica). Вирусы 11 , 979 (2019).

    CAS PubMed Central Google Scholar

  • 42.

    Zhang, T., Wu, Q. & Zhang, Z. Вероятное происхождение SARS-CoV-2, связанного со вспышкой COVID-19, панголином. Curr. Биол. 30 , 1346–1351 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 43.

    Shi, J. et al. Восприимчивость хорьков, кошек, собак и других домашних животных к SARS-коронавирусу 2. Science 368 , 1016–1020 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 44.

    Орешкова Н. и др. Инфекция SARS-CoV-2 у выращиваемых норок, Нидерланды, апрель и май 2020 г. Euro Surveill. 25 , 2001005 (2020).

    PubMed Central Google Scholar

  • 45.

    Sit, T.H.C. et al. Заражение собак SARS-CoV-2. Природа https://doi.org/10.1038/s41586-020-2334-5 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 46.

    Zhang, Q. et al. Серологическое исследование SARS-CoV-2 у кошек в Ухане. Emerg. Микробы заражают. https://doi.org/10.1080/22221751.2020.1817796 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 47.

    Hoffmann, M. et al. Вход в клетки SARS-CoV-2 зависит от ACE2 и TMPRSS2 и блокируется клинически доказанным ингибитором протеазы. Ячейка 181 , 271–280 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 48.

    Chandrashekar, A. et al. Инфекция SARS-CoV-2 защищает макак-резус от повторного заражения. Наука 369 , 812–817 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 49.

    Zhao, X. et al. Широкое и дифференцированное использование рецептора ангиотензинпревращающего фермента 2 животных SARS-CoV-2. J. Virol. 94 , e00940-20 (2020).

    PubMed PubMed Central Google Scholar

  • 50.

    Shang, J. et al. Структурные основы распознавания рецепторов SARS-CoV-2. Природа 581 , 221–224 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 51.

    Walls, A.C. et al. Структура, функция и антигенность гликопротеина шипа SARS-CoV-2. Ячейка 181 , 281–292 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 52.

    Ван, Ю., Шан, Дж., Грэм, Р., Барик, Р.С. и Ли, Ф. Распознавание рецепторов новым коронавирусом из Ухани: анализ, основанный на десятилетних структурных исследованиях коронавируса SARS . J. Virol. 94 , e00127-20 (2020).

    PubMed PubMed Central Google Scholar

  • 53.

    Летко, М., Марци, А. и Манстер, В. Функциональная оценка входа в клетки и использования рецепторов для SARS-CoV-2 и других бета-коронавирусов линии B. Nat. Microbiol. 5 , 562–569 (2020).

    CAS PubMed Google Scholar

  • 54.

    Ou, X. et al. Характеристика спайкового гликопротеина SARS-CoV-2 при проникновении вируса и его иммунная перекрестная реактивность с SARS-CoV. Nat. Commun. 11 , 1620 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 55.

    Shang, J. et al. Механизмы входа в клетки SARS-CoV-2. Proc. Natl Acad. Sci. США 117 , 11727–11734 (2020).

    CAS Google Scholar

  • 56.

    Sungnak, W. et al. Факторы проникновения SARS-CoV-2 высоко экспрессируются в эпителиальных клетках носа вместе с генами врожденного иммунитета. Nat. Med. 26 , 681–687 (2020).

    CAS Google Scholar

  • 57.

    Lukassen, S. et al. Рецептор SARS-CoV-2 ACE2 и TMPRSS2 в первую очередь экспрессируются в транзиторных секреторных клетках бронхов. EMBO. J. 39 , e105114 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 58.

    Wrapp, D. et al. Крио-ЭМ структура пика 2019-нКоВ в конформации до слияния. Наука 367 , 1260–1263 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 59.

    Yuan, Y. et al. Крио-ЭМ структуры гликопротеинов спайков БВРС-КоВ и SARS-CoV выявляют динамические домены связывания рецепторов. Nat. Commun. 8 , 15092 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 60.

    Huang, C. et al. Клинические особенности пациентов, инфицированных новым коронавирусом 2019 г., в Ухане, Китай. Ланцет 395 , 497–506 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 61.

    Mehta, P. et al. COVID-19: рассмотрите синдромы цитокинового шторма и иммуносупрессию. Ланцет 395 , 1033–1034 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 62.

    Wu, C. et al. Факторы риска, связанные с острым респираторным дистресс-синдромом и смертью пациентов с пневмонией, вызванной коронавирусом 2019 г., в Ухане, Китай. JAMA Intern. Med. 180 , 934–943 (2020).

    CAS Google Scholar

  • 63.

    Liu, Y. et al. Связь между возрастом и клиническими характеристиками и исходами COVID-19. Eur. Респир. Дж. 55 , 2001112 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 64.

    Tian, ​​J. et al. Клинические характеристики и факторы риска, связанные с тяжестью заболевания COVID-19 у онкологических больных в Ухане, Китай: многоцентровое ретроспективное когортное исследование. Ланцет Онкол. 21 , 893–903 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 65.

    Yao, X.H. et al. [Патологический отчет о трех случаях COVID-19 при минимально инвазивном вскрытии]. Чжунхуа Бинг Ли Сюэ За Чжи 49 , 411–417 (2020).

    CAS Google Scholar

  • 66.

    Martines, R. B. et al. Патология и патогенез SARS-CoV-2, связанный со смертельным исходом от коронавируса, США. Emerg. Заразить. Дис. 26 , 2005–2015 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 67.

    Zeng, Z. et al. Легочная патология ранней фазы пневмонии COVID-19 у пациента с доброкачественным поражением легких. Гистопатология https://doi.org/10.1111/his.14138 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 68.

    Sun, S.H. et al. Мышиная модель инфекции и патогенеза SARS-CoV-2. Клеточный микроб-хозяин 28 , 124–133 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 69.

    Роккс, Б.и другие. Сравнительный патогенез COVID-19, MERS и SARS на нечеловеческой модели приматов. Наука 368 , 1012–1015 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 70.

    Bao, L. et al. Патогенность SARS-CoV-2 у трансгенных мышей hACE2. Природа 583 , 830–833 (2020).

    CAS Google Scholar

  • 71.

    Jiang, R.D. et al. Патогенез SARS-CoV-2 у трансгенных мышей, экспрессирующих человеческий ангиотензин-превращающий фермент 2. Cell 182 , 50–58 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 72.

    Lu, S. et al. Сравнение нечеловеческих приматов выявило подходящую модель для COVID-19. Sig. Transduct. Цель. Ther. 5 , 157 (2020).

    CAS Google Scholar

  • 73.

    Speranza, E. et al. Динамика инфицирования SARS-CoV-2 в легких африканских зеленых мартышек. Препринт на biorxiv https://www.biorxiv.org/content/10.1101/2020.08.20.258087v1 (2020).

  • 74.

    Gu, H. et al. Адаптация SARS-CoV-2 у мышей BALB / c для тестирования эффективности вакцины. Наука https://doi.org/10.1126/science.abc4730 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 75.

    Munster, V.J. et al. Респираторное заболевание у макак-резусов, зараженных SARS-CoV-2. Природа 585 , 268–272 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 76.

    Yu, P. et al. Возрастные модели макак-резусов COVID-19. Animal Model Exp. Med. 3 , 93–97 (2020).

    Google Scholar

  • 77.

    Chan, J. F. et al. Моделирование клинических и патологических проявлений коронавирусной болезни 2019 (COVID-19) в модели золотого сирийского хомяка: последствия для патогенеза и передачи заболевания. Clin. Заразить. Дис. https://doi.org/10.1093/cid/ciaa325 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 78.

    Kim, Y. I. et al. Инфекция и быстрое распространение SARS-CoV-2 у хорьков. Клеточный микроб-хозяин 27 , 704–709 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 79.

    Ричард М. и др. SARS-CoV-2 передается через контакт и по воздуху между хорьками. Nat. Commun. 11 , 3496 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 80.

    Wang, D. et al.Клинические характеристики 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 г., в Ухане, Китай. JAMA 323 , 1061–1069 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 81.

    Guan, W. J. et al. Клиническая характеристика коронавирусной болезни 2019 в Китае. N. Engl. J. Med. 382 , 1708–1720 (2020).

    CAS Google Scholar

  • 82.

    Lu, X. et al. Инфекция SARS-CoV-2 у детей. N. Engl. J. Med. 382 , 1663–1665 (2020).

    Google Scholar

  • 83.

    Chen, H. et al. Клинические характеристики и потенциал вертикальной внутриутробной передачи инфекции COVID-19 у девяти беременных женщин: ретроспективный обзор медицинских карт. Ланцет 395 , 809–815 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 84.

    Vivanti, A.J. et al. Трансплацентарная передача инфекции SARS-CoV-2. Nat. Commun. 11 , 3572 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 85.

    Giacomelli, A. et al. Самостоятельно сообщаемые обонятельные и вкусовые расстройства у пациентов с SARS-CoV-2: кросс-секционное исследование. Clin. Заразить. Дис. 71 , 889–890 (2020).

    CAS Google Scholar

  • 86.

    Chen, T. et al. Клиническая характеристика 113 умерших пациентов с коронавирусной болезнью 2019: ретроспективное исследование. BMJ 368 , m1091 (2020).

    PubMed PubMed Central Google Scholar

  • 87.

    Yang, X. et al. Клиническое течение и исходы тяжелобольных пациентов с пневмонией SARS-CoV-2 в Ухане, Китай: одноцентровое ретроспективное наблюдательное исследование. Ланцет Респир. Med. 8 , 475–481 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 88.

    Нишура, Х., Линтон, Н. М. и Ахметжанов, А. Р. Первоначальный кластер инфекций нового коронавируса (2019-nCoV) в Ухане, Китай, соответствует значительному уровню передачи инфекции от человека человеку. J. Clin. Med. 9 , 488 (2020).

    PubMed Central Google Scholar

  • 89.

    Li, R. et al. Существенная недокументированная инфекция способствует быстрому распространению нового коронавируса (SARS-CoV-2). Наука 368 , 489–493 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 90.

    Petersen, E. et al. Сравнение SARS-CoV-2 с SARS-CoV и пандемиями гриппа. Lancet Infect. Дис. 20 , e238 – e244 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 91.

    Yu, P., Zhu, J., Zhang, Z. & Han, Y. Семейный кластер инфекции, связанный с новым коронавирусом 2019 года, указывающий на возможную передачу от человека к человеку во время инкубационного периода. J. Infect. Дис. 221 , 1757–1761 (2020).

    CAS Google Scholar

  • 92.

    Миддлтон, Дж., Рейнтьес, Р. и Лопес, Х. Мясные фабрики - новая линия фронта в пандемии COVID-19. BMJ 370 , m2716 (2020).

    Google Scholar

  • 93.

    Джуб, Б. и Виваниткит, В. COVID-19 и рабочие-мигранты: отсутствие данных и необходимость особого управления. Общественное здравоохранение 183 , 64 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 94.

    Houlihan, C.F. et al. Пик пандемии SARS-CoV-2 и уровни сероконверсии среди медицинских работников Лондона. Ланцет 396 , e6 – e7 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 95.

    Peiris, J. S. et al. Клиническое прогрессирование и вирусная нагрузка при вспышке коронавирус-ассоциированной пневмонии SARS: проспективное исследование. Ланцет 361 , 1767–1772 (2003).

    CAS PubMed PubMed Central Google Scholar

  • 96.

    Zou, L. et al. Вирусная нагрузка SARS-CoV-2 в образцах верхних дыхательных путей инфицированных пациентов. N. Engl. J. Med. 382 , 1177–1179 (2020).

    PubMed PubMed Central Google Scholar

  • 97.

    Wolfel, R. et al. Вирусологическая оценка госпитализированных пациентов с COVID-2019. Природа https://doi.org/10.1038/s41586-020-2196-x (2020).

    Артикул Google Scholar

  • 98.

    Стадницкий В., Бакс К. Э., Бакс А. и Анфинруд П. Время жизни маленьких речевых капель в воздухе и их потенциальное значение в передаче SARS-CoV-2. Proc. Natl Acad. Sci. США 117 , 11875–11877 (2020).

    CAS Google Scholar

  • 99.

    Мезельсон, М. Капли и аэрозоли при передаче SARS-CoV-2. N. Engl. J. Med. 382 , 2063 (2020).

    Google Scholar

  • 100.

    van Doremalen, N. et al. Аэрозольная и поверхностная стабильность SARS-CoV-2 по сравнению с SARS-CoV-1. N. Engl. J. Med. 382 , 1564–1567 (2020).

    Google Scholar

  • 101.

    Lu, C. W., Liu, X. F. и Jia, Z. F. Нельзя игнорировать передачу 2019-nCoV через глазную поверхность. Ланцет 395 , e39 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 102.

    Wu, Y. et al. Длительное присутствие вирусной РНК SARS-CoV-2 в образцах фекалий. Ланцет Гастроэнтерол. Гепатол. 5 , 434–435 (2020).

    PubMed PubMed Central Google Scholar

  • 103.

    Кампф, Г., Тодт, Д., Пфаендер, С. и Стейнманн, Э. Устойчивость коронавирусов на неодушевленных поверхностях и их инактивация биоцидными агентами. J. Hosp. Заразить. 104 , 246–251 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 104.

    Chinazzi, M. et al. Влияние ограничений на поездки на распространение вспышки нового коронавируса (COVID-19) в 2019 году. Наука 368 , 395–400 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 105.

    Лу, Н., Ченг, К. В., Камар, Н., Хуанг, К. К. и Джонсон, Дж.A. Выдерживание урагана COVID-19: успешные меры контроля пяти азиатских стран. Am. J. Infect. Контроль 48 , 851–852 (2020).

    PubMed PubMed Central Google Scholar

  • 106.

    Bordi, L. et al. Дифференциальная диагностика заболеваний у пациентов, находящихся под обследованием на новый коронавирус (SARS-CoV-2), Италия, февраль 2020 г. евро Surveill. 25 , 2000170 (2020).

    PubMed Central Google Scholar

  • 107.

    Chan, J. F. et al. Улучшенная молекулярная диагностика COVID-19 с помощью нового высокочувствительного и специфичного COVID-19-RdRp / Hel анализа с обратной транскрипцией в режиме реального времени, подтвержденного in vitro и на клинических образцах. J. Clin. Microbiol. 58 , e00310-20 (2020).

    PubMed PubMed Central Google Scholar

  • 108.

    Corman, V. M. et al. Обнаружение нового коронавируса 2019 года (2019-nCoV) методом ОТ-ПЦР в реальном времени. евро Surveill. 25 , 2000045 (2020).

    PubMed PubMed Central Google Scholar

  • 109.

    Konrad, R. et al. Быстрое создание лабораторной диагностики нового коронавируса SARS-CoV-2 в Баварии, Германия, февраль 2020 г. евро Surveill. 25 , 2000173 (2020).

    PubMed Central Google Scholar

  • 110.

    Lu, R. et al. Разработка нового метода изотермической амплификации, опосредованного обратной транскрипцией, для быстрого обнаружения SARS-CoV-2. Virol. Грех. 35 , 344–347 (2020).

    CAS Google Scholar

  • 111.

    Cordes, A. K. & Heim, A. Быстрое обнаружение случайным доступом нового SARS-коронавируса-2 (SARS-CoV-2, ранее 2019-nCoV) с использованием протокола открытого доступа для слияния пантер. Дж.Clin. Virol. 125 , 104305 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 112.

    Пан, Ю., Чжан, Д., Ян, П., Пун, Л. Л. М. и Ван, К. Вирусная нагрузка SARS-CoV-2 в клинических образцах. Lancet Infect. Дис. 20 , 411–412 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 113.

    К, К.K. et al. Постоянное обнаружение нового коронавируса 2019 года в слюне. Clin. Заразить. Дис. 71 , 841–843 (2020).

    CAS Google Scholar

  • 114.

    Wang, W. et al. Обнаружение SARS-CoV-2 в различных типах клинических образцов. JAMA 323 , 1843–1844 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 115.

    Han, H., Luo, Q., Mo, F., Long, L. & Zheng, W. РНК SARS-CoV-2 легче обнаруживается в индуцированной мокроте, чем в мазках из горла выздоравливающих пациентов с COVID-19. Lancet Infect. Дис. 20 , 655–656 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 116.

    Zhang, W. et al. Молекулярное и серологическое исследование пациентов, инфицированных 2019-nCoV: наличие нескольких путей выделения. Emerg. Микробы заражают. 9 , 386–389 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 117.

    Ли Т. Диагностика и клиническое ведение инфекции, вызванной тяжелым острым респираторным синдромом, вызванным коронавирусом 2 (SARS-CoV-2): оперативная рекомендация больницы Пекинского союзного медицинского колледжа (V2.0). Emerg. Микробы заражают. 9 , 582–585 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 118.

    Xie, X. et al. КТ грудной клетки при типичной пневмонии 2019-nCoV: связь с отрицательным результатом ОТ-ПЦР. Радиология 296 , E41 – E45 (2020).

    Google Scholar

  • 119.

    Канне, Дж. П. и Чест, К. Т. Результаты заражения новым коронавирусом (2019-nCoV) 2019 г. из Ухани, Китай: ключевые моменты для радиолога. Радиология 295 , 16–17 (2020).

    Google Scholar

  • 120.

    Guo, L. et al. Профилирование раннего гуморального ответа для диагностики нового коронавирусного заболевания (COVID-19). Clin. Заразить. Дис. 71 , 778–785 (2020).

    CAS Google Scholar

  • 121.

    To, K. K. et al. Временные профили вирусной нагрузки в образцах слюны задней части ротоглотки и ответы сывороточных антител во время инфекции SARS-CoV-2: наблюдательное когортное исследование. Lancet Infect. Дис. 20 , 565–574 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 122.

    Wang, X. et al. Препарат против вируса гриппа, арбидол, является эффективным ингибитором SARS-CoV-2 in vitro. Cell Discov. 6 , 28 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 123.

    Zhu, Z. et al. Монотерапия арбидолом превосходит лопинавир / ритонавир в лечении COVID-19. J. Infect. 81 , e21 – e23 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 124.

    Li, Y. et al. Эффективность и безопасность лопинавира / ритонавира или арбидола у взрослых пациентов с COVID-19 легкой / умеренной степени тяжести: поисковое рандомизированное контролируемое исследование. Med https://doi.org/10.1016/j.medj.2020.04.001 (2020).

    Артикул Google Scholar

  • 125.

    Lian, N. et al. Лечение умифеновиром не связано с улучшением результатов у пациентов с коронавирусной болезнью 2019: ретроспективное исследование. Clin. Microbiol. Заразить. 26 , 917–921 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 126.

    Кавасе, М., Ширато, К., ван дер Хук, Л., Тагучи, Ф. и Мацуяма, С. Одновременная обработка клеток бронхиального эпителия человека ингибиторами серина и цистеиновых протеаз предотвращает тяжелый острый респираторный синдром. проникновение коронавируса. J. Virol. 86 , 6537–6545 (2012).

    CAS PubMed PubMed Central Google Scholar

  • 127.

    Zhou, Y. et al. Ингибиторы протеазы, направленные на проникновение коронавирусов и филовирусов. Antiviral Res. 116 , 76–84 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 128.

    Wang, M. et al. Ремдесивир и хлорохин эффективно подавляют недавно появившийся новый коронавирус (2019-nCoV) in vitro. Cell Res. 30 , 269–271 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 129.

    Yao, X. et al. Противовирусная активность in vitro и разработка оптимизированной схемы дозирования гидроксихлорохина для лечения тяжелого острого респираторного синдрома, вызванного коронавирусом 2 (SARS-CoV-2). Clin. Заразить. Дис. 71 , 732–739 (2020).

    CAS Google Scholar

  • 130.

    Rosenberg, E. S. et al. Связь лечения гидроксихлорохином или азитромицином с внутрибольничной смертностью у пациентов с COVID-19 в штате Нью-Йорк. JAMA 323 , 2493–2502 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 131.

    Geleris, J. et al. Обсервационное исследование гидроксихлорохина у госпитализированных пациентов с Covid-19. N. Engl. J. Med. 382 , 2411–2418 (2020).

    CAS Google Scholar

  • 132.

    Monteil, V. et al. Ингибирование инфекций SARS-CoV-2 в тканях человека с использованием растворимого человеческого ACE2 клинического уровня. Ячейка 181 , 905–913 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 133.

    Tian, ​​X. et al. Сильное связывание спайкового белка нового коронавируса 2019 года человеческими моноклональными антителами, специфичными для коронавируса SARS. Emerg. Микробы заражают. 9 , 382–385 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 134.

    Xia, S. et al. Ингибирование инфекции SARS-CoV-2 (ранее 2019-nCoV) с помощью мощного ингибитора слияния панкоронавируса, нацеленного на его спайковый белок, обладающий высокой способностью опосредовать слияние мембран. Cell Res. 30 , 343–355 (2020).

    CAS Google Scholar

  • 135.

    Уль Камар, М. Т., Алкахтани, С. М., Аламри, М. А. и Чен, Л. Л. Структурная основа открытия лекарств от SARS-CoV-2 3CL (pro) и анти-COVID-19 из лекарственных растений. J. Pharm. Анальный. 10 , 313–319 (2020).

    Google Scholar

  • 136.

    Williamson, B.N. et al. Клиническая польза ремдесивира у макак-резусов, инфицированных SARS-CoV-2. Природа 585 , 273–276 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 137.

    Grein, J. et al. Сострадательное применение ремдесивира пациентам с тяжелой формой Covid-19. N. Engl. J. Med. 382 , 2327–2336 (2020).

    CAS Google Scholar

  • 138.

    Beigel, J.H. et al. Ремдесивир для лечения Covid-19 - предварительное сообщение. N. Engl. Дж. Мед https://doi.org/10.1056/NEJMoa2007764 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 139.

    Cai, Q. et al. Экспериментальное лечение COVID-19 фавипиравиром: открытое контрольное исследование. Engineering https://doi.org/10.1016/j.eng.2020.03.007 (2020).

    Артикул Google Scholar

  • 140.

    Группа изучения фавипиравира. Предварительный отчет обсервационного исследования фавипиравира в Японии. Японская ассоциация инфекционных заболеваний. http://www.kansensho.or.jp/uploads/files/topics/2019ncov/covid19_casereport_en_200529.pdf (2020).

  • 141.

    Chen, F. et al. Чувствительность 10 клинических изолятов коронавируса SARS к выбранным противовирусным соединениям in vitro. J. Clin. Virol. 31 , 69–75 (2004).

    PubMed PubMed Central Google Scholar

  • 142.

    de Wilde, A.H. et al. Скрининг одобренной FDA библиотеки соединений выявил четыре низкомолекулярных ингибитора репликации коронавируса ближневосточного респираторного синдрома в культуре клеток. Антимикробный. Агенты Chemother. 58 , 4875–4884 (2014).

    PubMed PubMed Central Google Scholar

  • 143.

    Cao, B. et al. Испытание применения лопинавира-ритонавира у взрослых, госпитализированных с тяжелым Covid-19. N. Engl. J. Med. 382 , 1787–1799 (2020).

    Google Scholar

  • 144.

    Hung, I. F. et al. Тройная комбинация интерферона бета-1b, лопинавира-ритонавира и рибавирина в лечении пациентов, госпитализированных с COVID-19: открытое рандомизированное исследование фазы 2. Ланцет 395 , 1695–1704 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 145.

    Главные следователи исследования RECOVERY по лопинавиру-ритонавиру. Отсутствие клинической пользы от использования лопинавира-ритонавира у госпитализированных пациентов с COVID-19, изученных в RECOVERY. Рандомизированная оценка исследования терапии COVID-19 (RECOVERY). https://www.recoverytrial.net/news/no-clinical-benefit-from-use-of-lopinavir-ritonavir-in-hospitalised-covid-19-patients-studied-in-recovery (2020).

  • 146.

    Совместная группа восстановления. и другие. Дексаметазон у госпитализированных пациентов с Covid-19 - предварительное сообщение. N. Engl. J. Med. https://doi.org/10.1056/NEJMoa2021436 (2020).

    Артикул Google Scholar

  • 147.

    Xu, X. et al. Эффективное лечение тяжелых пациентов с COVID-19 с помощью тоцилизумаба. Proc. Natl Acad. Sci. США 117 , 10970–10975 (2020).

    CAS Google Scholar

  • 148.

    Diurno, F. et al. Лечение экулизумабом у пациентов с COVID-19: предварительные результаты из реального опыта ASL Napoli 2 Nord. Eur. Rev. Med. Pharmacol. Sci. 24 , 4040–4047 (2020).

    CAS Google Scholar

  • 149.

    Стокман, Л. Дж., Беллами, Р. и Гарнер, П. SARS: систематический обзор эффектов лечения. PLoS Med. 3 , e343 (2006).

    PubMed PubMed Central Google Scholar

  • 150.

    Мантло, Э., Букреева, Н., Маруяма, Дж., Паесслер, С. и Хуанг, С. Противовирусная активность интерферонов типа I в отношении инфекции SARS-CoV-2. Antiviral Res. 179 , 104811 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 151.

    Sallard, E., Lescure, F. X., Yazdanpanah, Y., Mentre, F. & Peiffer-Smadja, N. Интерфероны типа 1 как потенциальное средство лечения COVID-19. Antiviral Res. 178 , 104791 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 152.

    Парк, А., Ивасаки, А. и интерфероны типа I и типа III - индукция, передача сигналов, уклонение и применение для борьбы с COVID-19. Клеточный микроб-хозяин 27 , 870–878 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 153.

    Duan, K. et al. Эффективность терапии выздоравливающей плазмой у пациентов с тяжелой формой COVID-19. Proc. Natl Acad. Sci. США 117 , 9490–9496 (2020).

    CAS Google Scholar

  • 154.

    Shen, C. et al. Лечение 5 тяжелобольных с COVID-19 плазмой реконвалесценции. JAMA 323 , 1582–1589 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 155.

    Wang, C. et al. Человеческое моноклональное антитело, блокирующее инфекцию SARS-CoV-2. Nat. Commun. 11 , 2251 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 156.

    Wu, Y. et al. Неконкурентная пара нейтрализующих антител человека блокирует связывание вируса COVID-19 с его рецептором ACE2. Наука 368 , 1274–1278 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 157.

    Zost, S.J. et al. Сильно нейтрализующие и защитные человеческие антитела против SARS-CoV-2. Природа 584 , 443–449 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 158.

    Shi, R. et al. Человеческое нейтрализующее антитело нацелено на рецептор-связывающий сайт SARS-CoV-2. Природа 584 , 120–124 (2020).

    CAS Google Scholar

  • 159.

    Smith, T. R. F. et al. Иммуногенность ДНК-вакцины-кандидата от COVID-19. Nat. Commun. 11 , 2601 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 160.

    Zhu, F. C. et al. Безопасность, переносимость и иммуногенность рекомбинантной вакцины против COVID-19 с вектором аденовируса 5-го типа: открытое, нерандомизированное исследование с увеличением дозы, первое на людях. Ланцет 395 , 1845–1854 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 161.

    Gao, Q. et al. Разработка инактивированной вакцины-кандидата от SARS-CoV-2. Наука 369 , 77–81 (2020).

    CAS Google Scholar

  • 162.

    Zhu, F. C. et al. Иммуногенность и безопасность вакцины COVID-19 с вектором рекомбинантного аденовируса 5-го типа для здоровых взрослых в возрасте 18 лет и старше: рандомизированное двойное слепое плацебо-контролируемое исследование фазы 2. Ланцет 396 , 479–488 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 163.

    Folegatti, P. M. et al. Безопасность и иммуногенность вакцины ChAdOx1 nCoV-19 против SARS-CoV-2: предварительный отчет фазы 1/2, простого слепого, рандомизированного контролируемого исследования. Ланцет 396 , 467–478 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 164.

    Джексон, Л. А. и др. МРНК-вакцина против SARS-CoV-2 - предварительный отчет. N. Engl. J. Med. https://doi.org/10.1056/NEJMoa2022483 (2020).

    Артикул PubMed PubMed Central Google Scholar

  • 165.

    Xia, S. et al. Влияние инактивированной вакцины против SARS-CoV-2 на безопасность и иммуногенность: промежуточный анализ 2 рандомизированных клинических испытаний. JAMA 324 , 1–10 (2020).

    PubMed PubMed Central Google Scholar

  • 166.

    Тан Д., Комиш П. и Канг Р. Признаки заболевания COVID-19. PLoS Pathog. 16 , e1008536 (2020).

    CAS PubMed PubMed Central Google Scholar

  • Эпидемиологические, клинические и вирусологические характеристики 74 случаев заболевания, инфицированного коронавирусом 2019 г. (COVID-19) с желудочно-кишечными симптомами

    г. Введение

    г.

    Вспышка заболевания, инфицированного новым коронавирусом (SARS-CoV-2) (COVID-19) ) началась в Ухане, провинция Хубэй, в декабре 2019 года1 и распространилась по всему Китаю, 2 увеличивая риск глобального распространения.3 Хотя китайское правительство быстро отреагировало и приняло решительные меры, включая карантин города Ухань 23 января, COVID-19 стал серьезной угрозой для здоровья населения и экономическим бременем для Китая. 9 февраля 2020 года, когда мы закончили сбор данных и начали анализ, было в общей сложности 37 251 подтвержденный, 28 942 подозреваемых и 6188 тяжелых / критических случаев, из которых 812 смертей и 2731 выписка из больницы, согласно официальным отчетам Национального здравоохранения. Комиссия. Эпидемиологические и клинические характеристики COVID-19 в Ухане были опубликованы в других источниках, 4 5 с оценочной динамикой ранней передачи, представленной как различные базовые репродуктивные числа (R 0 ) из ​​2.26 и 2,68,7, что указывает на высокую способность передачи вируса.

    SARS-CoV-2 был седьмым коронавирусом, который китайскими властями был идентифицирован как способный инфицировать человека. Его геномные особенности были выявлены у пациента из Ухани, показав 89% и 82% сходства последовательностей ядерной кислоты с Bat SARS-CoVZXC21 и SARS-CoV человека 8 соответственно. Дальнейшие функциональные исследования показали, что белок spike (S) 2019-nCoV имеет высокое сродство к ACE2, который отвечает за вирусную инвазию.9 Хорошо известно, что вирусные мутации происходят во время передачи и распространения.Поэтому мы хотели бы знать способность к мутации и передаче, изменение вирулентности и связанные с ними клинические особенности SARS-CoV-2 во время его распространения.

    В настоящее время большинство опубликованных данных сосредоточено на Ухане, сообщая о примерно 11% летальности, вызванной различными осложнениями, такими как острый респираторный дистресс-синдром (ОРДС) и острая дыхательная недостаточность.4 Однако, поскольку Ухань является первоначальным местом расположения SARS-CoV. -2 вспышка, вспышка заболевания вызвала нехватку ресурсов здравоохранения; следовательно, в больницы принимали только пациентов с тяжелыми / критическими заболеваниями.Кроме того, «поездки на весенние праздники», особенно на поезде, значительно увеличивают риск распространения вируса.10 Поэтому необходимо изучить особенности COVID-19 в районах за пределами Ухани. Начиная с 17 января, SARS-CoV-2 был впервые выявлен в провинции Чжэцзян, в конечном итоге достигнув 1117 случаев к 11 февраля, при этом 10,54% случаев имели более низкий тяжелый / критический тип COVID-19 и нулевые случаи смерти.

    Поскольку в последнем исследовании сообщалось об обнаружении нуклеиновой кислоты SARS-CoV-2 в фекалиях пациентов11, а анализ отдельных клеток показал, что пищеварительная система является потенциальным путем заражения вирусом, 12 теоретически вероятно, что часть пациентов может иметь Симптомы со стороны желудочно-кишечного тракта.Мы должны очень осторожно относиться к этим предположениям, поскольку амбулаторные центры эндоскопии желудочно-кишечного тракта могут стать местами повышенного риска. Более того, врачи, работающие в этих центрах, могут вести себя менее бдительно, с более низким уровнем личного защитного снаряжения по сравнению с врачами, работающими в клиниках, обслуживающих пациентов с лихорадкой, что неосознанно подвергает практикующих врачей-практиков высокому риску заражения. Поэтому в этом исследовании мы представляем первый отчет об эпидемиологических, клинических и вирусологических характеристиках пациентов с COVID-19 с симптомами желудочно-кишечного тракта за пределами Ухани, что полезно для контроля заболеваний и защиты медицинского персонала.

    Методы

    Источники данных и этика

    Было проведено ретроспективное исследование эпидемиологических, клинических и вирусологических характеристик COVID-19 в период с 17 января 2020 года по 8 февраля 2020 года. Данные были единообразно собраны Комиссией здравоохранения провинции Чжэцзян в назначенных больницах, при этом у всех успешно зачисленных пациентов был диагностирован COVID-19 в соответствии с временным руководством ВОЗ.13 Наши предварительные данные были переданы властям провинции Чжэцзян и открыты для обмена. КТО.Письменное информированное согласие было отклонено комиссией по этике указанной больницы, поскольку это исследование проводилось с целью выявления новых инфекционных заболеваний и является частью продолжающегося расследования вспышки болезни в рамках государственного здравоохранения.

    Для определения положительных симптомов со стороны желудочно-кишечного тракта у пациентов должен быть хотя бы один из следующих симптомов: тошнота, рвота и диарея. Симптомы со стороны желудочно-кишечного тракта регистрировались при поступлении, исключая влияние другой медикаментозной терапии и внешних факторов.Определением диареи было выделение жидкого стула> 3 раз в день. Посев кала был выполнен с отрицательными результатами для всех пациентов с COVID-19 с симптомами желудочно-кишечного тракта. Поскольку диарея была диагностирована при поступлении, у этих пациентов не было истории недавнего применения антибиотиков. Следовательно, Clostridium difficile не был обнаружен в стуле. Пациенты с COVID-19 были разделены на четыре подтипа в зависимости от степени тяжести заболевания на основе схемы диагностики и лечения SARS-CoV-2 в Китае (шестое издание).Легкий тип определяется как наличие легких клинических симптомов без пневмонии при рентгенографии. Распространенный тип определяется как проявление лихорадки и / или респираторных симптомов плюс пневмония при рентгенографии. Тяжелый тип диагностировали по одышке (частота дыхания (ЧД) ≥30 раз / мин), сатурация пальца кислородом в покое ≤93%, артерия PaO 2 / FiO 2 ≤300 мм рт. Ст. (1 мм рт. Ст. = 0,133 кПа ). Критический тип определяется как дыхательная недостаточность с шоком и полиорганной недостаточностью, требующей искусственной вентиляции легких и госпитализации в отделение интенсивной терапии (ОИТ).Определение повреждения печени: аланинаминотрансфераза (АЛТ)> 50 Ед / л или аспартатаминотрансфераза (АСТ)> 40 Ед / л. Инкубационный период рассчитывался от конкретной даты контакта подтвержденного пациента с COVID-19 до момента начала заболевания.

    Процедуры

    Эпидемиологические, клинические, лабораторные, терапевтические данные и данные о результатах были собраны из медицинских карт пациентов с проверкой независимыми врачами. Клинические результаты отслеживались до 8 февраля 2020 года, когда были взяты образцы из мазков из зева и мокроты.В случае отсутствия или нечеткости данных осуществлялась прямая связь с лечащими врачами и другими поставщиками медицинских услуг. Лабораторное подтверждение SARS-CoV-2 было выполнено в нашей больнице и Центре по контролю и профилактике заболеваний на уровне провинции / города Чжэцзян с разрешения ранее сообщенной ОТ-ПЦР в реальном времени.5 Все пациенты прошли рентгенографию грудной клетки или КТ при поступлении. тогда как другие респираторные вирусы были исключены, такие как грипп A (h2N1, h4N2 и H7N9), грипп B, респираторно-синцитиальный вирус, вирус парагриппа, аденовирус, SARS-CoV и MERS-CoV.

    Результаты

    В этом исследовании мы собрали и рассчитали эпидемиологические данные (воздействие на зараженную зону, контакт с подтвержденными / подозреваемыми пациентами с COVID-19, кластерная ситуация и средний инкубационный период) и другие антропометрические данные, демографические данные, симптомы и признаки при госпитализации. . Также были обобщены результаты лабораторных исследований и рентгенографии / КТ грудной клетки, сопутствующие заболевания, методы лечения (включая лекарственные препараты, интенсивную терапию и механическую вентиляцию легких) и клинические исходы.

    Выравнивание последовательностей, прогнозирование сайта транскрипционного метилирования и электростатический анализ модели белка

    Генные последовательности SARS (AAS00003.1 и AY278489.2) и Wuhan-Hu-1 (MN

  • 7.3) были получены из базы данных вирусного генома NCBI (https://www.ncbi.nlm.nih.gov/). ZJ01 был выделен и назван в честь пациента из провинции Чжэцзян (онлайн-дополнительные материалы - последовательность ZJ01). SRAMP (http://www.cuilab.cn/sramp) использовался для анализа последовательностей генов и прогнозирования сайтов модификации посттранскрипционного метилирования (N6-метиладенозин). Согласно результатам, соответствующие прогнозируемые участки m 6 A можно разделить на четыре уровня: очень высокий, высокий, средний и низкий уровень достоверности.Multalin (http://multalin.toulouse.inra.fr/multalin/multalin.html) использовался для сравнения различий между этими последовательностями. Онлайн-сервер SWISS-MODEL (https://swissmodel.expasy.org/) был использован для реконструкции трехмерной структуры белков в соответствии с генами или аминокислотными последовательностями. Уравнение Пуассона-Больцмана можно использовать для расчета электростатического поведения белка S в водном растворе с помощью функции электростатики вакуума PyMol. Дальнейший анализ мощности модели белка показал различие в распределении электростатической мощности на поверхности белка трех штаммов вируса.

    Статистический анализ

    Для непрерывных переменных использовались среднее (стандартное отклонение) и медиана (IQR) для нормально и аномально распределенных данных с последующим непарным t-критерием и непараметрическим тестом, когда это необходимо. Категориальные переменные выражали в виде числа (%) и сравнивали с использованием критерия χ 2 . Для выявления факторов риска тяжелых / критических пациентов использовался одномерный логистический регрессионный анализ. Все значимые переменные, полученные в результате одномерного анализа, были включены в модель многомерной логистической регрессии с прямым методом для определения независимых предикторов тяжелого / критического типа.Никакой корректировки для множественного тестирования не производилось. Двусторонний α <0,05 считался статистически значимым, и SPSS (V.26.0) использовался для всех анализов.

    Результаты

    Демографические и эпидемиологические характеристики

    В этом исследовании участвовал 651 пациент с подтвержденным COVID-19 с 17 января 2020 года по 8 февраля 2020 года в провинции Чжэцзян, среди которых 74 (11,4%) пациента имели по крайней мере один симптом со стороны желудочно-кишечного тракта ( тошнота, рвота и диарея), что было выше, чем предыдущие данные по Ухани (таблица 1).В частности, из 74 пациентов с COVID-19 с симптомами желудочно-кишечного тракта у 53 пациентов был только симптом диареи, у 11 пациентов был только симптом рвоты, а у 10 пациентов был только симптом тошноты. Кроме того, только у трех пациентов наблюдались все желудочно-кишечные симптомы диареи, рвоты и тошноты, тогда как у четырех пациентов наблюдались симптомы как тошноты, так и рвоты. Диарея была наиболее частым симптомом со стороны желудочно-кишечного тракта в этом исследовании и составляла 8,14% от общего числа включенных 651 пациента с COVID-19, что было выше, чем показатель 3.8% сообщили об этом ранее14. Из 53 пациентов с COVID-19 с диареей средняя продолжительность периода составила 4 дня (IQR: 3–6 дней), самая короткая продолжительность - 1 день, а самая длинная - 9 дней. Большинство поносов проходили самостоятельно.

    Таблица 1

    Демографические и эпидемиологические характеристики пациентов с COVID-19 с симптомами желудочно-кишечного тракта и без них

    Средний возраст пациентов с симптомами желудочно-кишечного тракта составлял 46,14 ± 14,19 лет, а соотношение мужчин и женщин составляло 1: 1. Не было никаких сопутствующих состояний рака, хронической почечной недостаточности, беременности, хронической обструктивной болезни легких или иммуносупрессии.Тридцать восемь (51,35%) пациентов имели историю контакта с Ухань и 32 (43,24%) пациента имели историю контактов с пациентами с COVID-19. Интересно, что частота хронических заболеваний печени составляла 10,81% у пациентов с COVID-19 с симптомами желудочно-кишечного тракта, что было значительно выше, чем у 2,95% пациентов без симптомов желудочно-кишечного тракта (p = 0,004). Что еще более важно, частота тяжелого / критического типа также была заметно увеличена у пациентов с COVID-19 с симптомами желудочно-кишечного тракта, чем у пациентов без симптомов желудочно-кишечного тракта (22,97% против 8.14%, р <0,001). Кластеризация семей - еще один ключевой феномен COVID-19. Мы определили, что 23 (31,08%) пациентов с симптомами желудочно-кишечного тракта имели семейную кластеризацию, которая была значительно выше, чем у пациентов без симптомов желудочно-кишечного тракта (20,45%, p = 0,037). У 21 пациента с COVID-19 с симптомами со стороны желудочно-кишечного тракта и у 195 пациентов без них было определенное время воздействия, при этом рассчитанный средний инкубационный период составлял 4 дня (3–7 дней IQR) и 5 ​​дней (3–8 дней IQR), соответственно.

    Клинические особенности и лабораторные отклонения

    Клинические характеристики пациентов с симптомами желудочно-кишечного тракта представлены в таблице 2.Наиболее частыми симптомами были лихорадка, кашель и выделение мокроты. Из вышеупомянутых симптомов у 29 (39,19%), 23 (31,08%), 8 (10,81%) и 16 (21,62%) пациентов с COVID-19 с симптомами желудочно-кишечного тракта была температура> 38,5 ° C, утомляемость, одышка и головная боль. соответственно, значительно выше, чем у их аналогов без симптомов со стороны желудочно-кишечного тракта. Из 74 пациентов с COVID-19 с симптомами желудочно-кишечного тракта у 63 (85,14%) была лихорадка, самая высокая температура - 40,3 ° C. Кроме того, у 21 пациента (28,38%) отсутствовали респираторные симптомы, такие как кашель и выделение мокроты, и имелись только желудочно-кишечные симптомы тошноты, рвоты и диареи.Более того, уровень повышения АСТ, но не АЛТ, был значительно выше у пациентов с COVID-19 с симптомами желудочно-кишечного тракта, чем у пациентов без симптомов желудочно-кишечного тракта (29,35 против 24,4, p = 0,02). Наконец, хотя большинство рентгенографических представлений у пациентов с COVID-19 с симптомами желудочно-кишечного тракта и без них были схожими, частота односторонней пневмонии составила 12,16% у пациентов с симптомами желудочно-кишечного тракта, намного ниже 23,22% у пациентов без симптомов желудочно-кишечного тракта (p = 0,030). Что касается маркеров, связанных с инфекцией, не было значительных различий как в прокальцитонине, так и в С-реактивном белке (СРБ) между пациентами с COVID-19 с симптомами желудочно-кишечного тракта и без них.

    Таблица 2

    Клинические характеристики и отдельные лабораторные отклонения от нормы пациентов с COVID-19 с симптомами ЖКТ и без них

    Осложнения и лечение

    Как показано в таблице 3, 5 (6,76%), 13 (17,57%) и 1 (1,35%) ) у пациента с COVID-19 с симптомами желудочно-кишечного тракта были осложнения в виде ОРДС, повреждения печени и шока, соответственно, причем первые два были значительно выше, чем их аналоги, на 2,08% и 8,84% у пациентов с COVID-19 без симптомов со стороны желудочно-кишечного тракта, соответственно (стр. = 0.034; р = 0,035). Все 74 пациента с COVID-19 с симптомами желудочно-кишечного тракта лечились изолированно с помощью поддерживающих и эмпирических препаратов, а 66 (89,19%) пациентов получали противовирусное лечение, включая спреи интерферона-α, капсулы арбидола гидрохлорида (две таблетки три раза в день), лопинавир и ритонавир по две таблетки (500 мг) два раза в день перорально. Кроме того, среднее время от начала заболевания до противовирусной терапии составило 5,56 ± 4,09 дня. По сравнению с данными из Ухани, у нас были более низкие показатели использования глюкокортикоидов и антибиотиков, 14.86% и 41,89% соответственно. Ни один из пациентов не получал непрерывную очистку крови из-за почечной недостаточности, и ни один из пациентов не проходил лечение экстракорпоральной мембранной оксигенацией. До сих пор умер только один пациент. Пять (6,76%) пациентов с COVID-19 с симптомами желудочно-кишечного тракта получали искусственную вентиляцию легких и переводились в отделение интенсивной терапии, что было значительно выше, чем у 2,08% пациентов с COVID-19 без симптомов со стороны желудочно-кишечного тракта (p = 0,034). .

    Таблица 3

    Осложнения и лечение пациентов с COVID-19 с симптомами желудочно-кишечного тракта и без них

    Прогнозирование факторов риска тяжелого / критического COVID-19 у пациентов с симптомами желудочно-кишечного тракта

    Из тяжелых / критических пациентов с COVID-19, 22.97% в этом исследовании имели симптомы со стороны желудочно-кишечного тракта. При сравнении с легким и распространенным COVID-19 первоначальный одномерный анализ эпидемиологических, клинических и лабораторных переменных выявил 11 значительно изменившихся факторов риска тяжелого / критического COVID-19, включая увеличение OR возраста, возраста ≥50 лет, периода между началом заболевания и посещение больницы, выделение мокроты, любое существующее заболевание, множественная легочная инфекция, АЛТ, лактатдегидрогеназа (ЛДГ), глюкоза и СРБ, а также снижение ОШ инфицированной области (дополнительная онлайн-таблица 1).На основе этих переменных был проведен дальнейший многомерный анализ с использованием прямого метода, и мы обнаружили, что производство мокроты у пациентов из инфицированных районов, таких как Ухань, и повышенные уровни ЛДГ / глюкозы были независимыми факторами риска тяжелого / критического COVID-19 у пациентов с Симптомы со стороны желудочно-кишечного тракта (таблица 4).

    Таблица 4

    Многомерный анализ факторов риска для тяжелых / критических пациентов с COVID-19 с симптомами ЖКТ

    Выравнивание последовательностей и анализ структуры модели белка

    ZJ01 - это штамм SARS-CoV-2 с 29 381 основанием.Результаты потенциальных сайтов метилирования последовательностей S-белка SARS, Wuhan-Hu-1 и ZJ01 показали, что существуют значительные различия между SARS-CoV-2 и SARS. Эти коронавирусы могут инфицировать клетки-хозяева, используя белок S для связывания с рецептором ACE2 на поверхности клетки-хозяина. Во время созревания вируса S-белки гликозилируются и делятся на части S1 и S2. S1 имеет сферическую форму и в основном участвует в распознавании и связывании вирусов с клетками-хозяевами. S2 выслеживается и может способствовать слиянию вируса с клетками-хозяевами.Результаты сравнения трех штаммов вируса показали, что ZJ01 и Wuhan-Hu-1 имеют один сайт с высокой степенью достоверности, два сайта со средней степенью достоверности и четыре сайта с низкой степенью достоверности. SARS имеет три сайта с высокой степенью достоверности, три сайта со средней степенью достоверности и пять сайтов с низкой степенью достоверности. С точки зрения сайтов с высокой степенью достоверности (рисунок 1A, красная стрелка) потенциальные точки метилирования SARS-CoV-2 (n = 1) и SARS (n = 3) преимущественно сосредоточены в сегментах S1 и S2 S белок. Положения двух сайтов с низкой степенью достоверности и одного сайта со средней степенью достоверности на S2 относительно фиксированы среди трех штаммов вируса (синяя стрелка).Эти результаты предполагают, что S-белки двух вирусов могут иметь структурные и функциональные различия из-за метилирования m 6 A во время транскрипции и трансляции.

    Рисунок 1

    Анализ структуры последовательности и белковой модели трех штаммов вируса. (A) Были проанализированы потенциальные сайты метилирования последовательностей генов S-белка SARS, Wuhan-Hu-1 и ZJ01. Красные стрелки представляют положения сайтов метилирования с высокой степенью достоверности в последовательностях гена S-белка. Синие стрелки представляют консервативные сайты метилирования в трех штаммах.(B) Аминокислотные последовательности белка Wuhan-Hu-1 и ZJ01 S выровнены. Черным прямоугольником отмечены сайты мутации. (C) Красный кружок отмечает разницу в распределении электростатической мощности в области рецептор-связывающего домена (RBD) между SARS и Wuhan-Hu-1. Зеленый эллипс указывает на изменение электростатического распределения белков S из-за мутации белка S ZJ01.

    Кроме того, результаты выравнивания последовательностей генов (рисунок 1B) показали, что вариации в последовательностях S-белка между ZJ01 и Wuhan-Hu-1 были незначительными, и эти вариации были сильно сконцентрированы в сегменте S2.Эти изменения привели к пяти аминокислотным заменам и двум аминокислотным делециям. Однако с точки зрения смоделированной трехмерной структуры белка влияние этих изменений на общую структуру белка S относительно ограничено. Разница между SARS-CoV-2 и SARS значительна, особенно в конкретном положении точки распознавания в сегменте S1 (рисунок 1C, красный кружок). С одной стороны, это изменение может повлиять на силу связывания вируса с клетками-хозяевами. С другой стороны, электростатические изменения между ZJ01 и Wuhan-Hu-1 в основном сосредоточены в зоне мутации S2 (рисунок 1C, зеленый эллипс), где подробные механизмы нуждаются в дальнейшем изучении.

    Обсуждение

    Национальное распространение и глобальное спорадическое появление SARS-CoV-2 стали огромной угрозой для людей, и эта угроза не ограничивается Китаем. Ученые предприняли попытку выявить эпидемиологические, клинические и вирусологические характеристики SARS-CoV-2, при этом к 5 февраля 2020 года в PubMed было опубликовано более 30 публикаций.2 4–7 Тем не менее, большинство этих исследований было сосредоточено на ситуации в Ухане, Китай. . Кроме того, инициатива по скринингу SARS-CoV-2 началась с лихорадочных клиник, в то время как лихорадка, кашель и одышка были наиболее выраженными симптомами, что увеличивает риск пропуска пациентов с другими симптомами и нормальной температурой тела.Теоретически правдоподобно, что одной из характеристик распространения вируса является повышенная способность передачи за счет снижения вирулентности, что также верно для SARS-CoV-2.15.Поэтому следует проявлять осторожность в отношении пациентов с подозрением на COVID-19, которые имели нормальное тело. температуры и посещал различные поликлиники по поводу не респираторных симптомов.

    Пациенты с подозрением на COVID-19 с желудочно-кишечными симптомами, такими как тошнота, рвота и диарея, должны быть серьезно рассмотрены, поскольку накопленные доказательства подтверждают передачу SARS-CoV-2 через фекалии11 и слезы16 и его способность связываться с ACE2 в желудочно-кишечном тракте. тракт не идентифицирован.9 12 В этом исследовании мы сообщили об эпидемиологических, клинических и вирусологических особенностях 74 пациентов с COVID-19 с симптомами желудочно-кишечного тракта из провинции Чжэцзян. Насколько нам известно, это первый отчет, в котором описывается положение пациентов с симптомами COVID-19 GI, и это самая большая группа случаев за пределами Ухани. Наши новые результаты имеют важное значение для профилактики заболеваний, поскольку они подчеркивают пациентов с подозрением на COVID-19 с желудочно-кишечными симптомами и их специфические клинические характеристики.

    Среди обследованных нами 651 пациента с COVID-19 доля пациентов с симптомами со стороны желудочно-кишечного тракта составила 11.4%, что выше, чем в ранее сообщенных данных в 3% из Ухани.4 Однако недавний отчет из Ухани показал, что 10,1% испытывали тошноту / диарею и 3,6% рвоту.17 Кроме того, последние данные из Ухани показали, что 79,1%. % пациентов с COVID-19 имели симптомы со стороны желудочно-кишечного тракта, но такие данные были собраны в течение 1–10 дней после начала заболевания и опубликованы в китайском национальном журнале 18, что отличается от нашей стратегии сбора данных о симптомах желудочно-кишечного тракта при поступлении, которые могут быть менее подвержены предвзятости из-за различные влияющие факторы, в том числе лекарственные.Что еще более важно, общенациональные данные показали симптомы со стороны желудочно-кишечного тракта у 8,7% из 1099 подтвержденных пациентов с SARS-CoV-2,14, что подкрепляет наши данные. Все эти данные указывают на изменение симптомов у пациентов с COVID-19. Мы подозреваем, что SARS-CoV-2 может вызывать острый гастрит и энтерит, о чем свидетельствуют рвота, тошнота и диарея. Поскольку предыдущие исследования показали высокую экспрессию ACE2 в желудочно-кишечном тракте, мы предполагаем, что такое изменение указывает на возможность мутации вируса в сторону повышенной трансмиссивности, снижения вирулентности и полиорганной инфекции, что отражено в клиниках увеличения R0 и путей заражения.В совокупности пациенты с COVID-19 показали повышенную тенденцию к распространению симптомов со стороны желудочно-кишечного тракта, что увеличивало риск заражения у медицинских работников, которые лечили пациентов с подозрением на COVID-19 без респираторных симптомов и лихорадки.

    Мы дополнительно проанализировали эпидемиологические и клинические характеристики пациентов с COVID-19 с симптомами желудочно-кишечного тракта. Мы выявили значительно более высокую частоту лихорадки> 38,5 ° C и кластеризации семей, увеличение осложнений ОРДС и тенденцию к высокой степени тяжести (частота тяжелого / критического типа, ИВЛ и госпитализация в ОИТ) у пациентов с COVID-19 с симптомами ЖКТ, когда по сравнению с пациентами без симптомов со стороны желудочно-кишечного тракта.Мы подозреваем, что симптомы со стороны желудочно-кишечного тракта могут повышать предрасположенность пациентов с COVID-19 к электролитным нарушениям, таким как значительное снижение уровня натрия в сыворотке (p = 0,016), и, следовательно, они имеют тенденцию к тяжелому / критическому типу заболевания. Следует рассмотреть и изучить другие причины на основе будущих данных. Кроме того, более высокие показатели семейной кластеризации могут быть связаны с выделением фекалий в общих туалетах в домохозяйствах. Дальнейший многомерный анализ выявил выделение мокроты из инфицированных областей и повышение уровней ЛДГ / глюкозы как независимых факторов риска заболевания.Кроме того, симптомы усталости, одышки и головной боли также были значительно выше у пациентов с COVID-19 с симптомами желудочно-кишечного тракта, что может быть вызвано их более высокой лихорадкой и повышенным дисбалансом электролитов. Следует тщательно контролировать повреждение печени, поскольку мы обнаружили значительно повышенный уровень АСТ и сопутствующие заболевания печени у пациентов с COVID-19 с симптомами желудочно-кишечного тракта. Поскольку процент хронических заболеваний печени был выше у пациентов с COVID-19 с симптомами желудочно-кишечного тракта, это могло привести к повышению уровня АЛТ и АСТ.Хотя не было значительных различий в терапии глюкокортикоидами и антибиотиками между пациентами с COVID-19 с симптомами желудочно-кишечного тракта и без них, они были ниже, чем их коллеги в Ухане, 4 что свидетельствует о нашем собственном опыте эффективной терапии.

    Изменение и мутация SARS-CoV-2 лежит в основе его изменчивости по эпидемиологическим и клиническим характеристикам. Используя углубленный биоинформатический анализ новой идентифицированной последовательности SARS-CoV-2 из провинции Чжэцзян, мы идентифицировали множество сайтов метилирования m 6 A в сегменте S1 ZJ01 и сегменте S2 SARS, что указывает на то, что S-белки двух вирусы могут иметь структурные и функциональные различия из-за метилирования m 6 A.Добавление химических модификаций имеет решающее значение для многих этапов процессинга мРНК и регуляции судьбы, в то время как наиболее распространенной внутренней модификацией является N 6 -метиладенозин.19 20 Учитывая широкую распространенность модификации m 6 A на клеточной мРНК, это Неудивительно, что ряд вирусов содержат m 6 A в своей РНК.21 22 Функция метилирования m 6 A в вирусах может быть разнообразной как для провирусной, так и для противовирусной роли.23 24 Коронавирусы представляют собой оболочечные РНК-вирусы, содержащие самые большие геном одноцепочечной положительно-смысловой РНК длиной от 25.5 и 32 т.п.н. 25 В отличие от ранее описанной модификации m 6 A в вирусах, метилирование в позиции N7 5'-кэп-структуры РНК коронавируса обычно идентифицируется, что облегчает распознавание вирусной РНК врожденным иммунитетом хозяина. system.26 Таким образом, наши данные о новом m 6 Ситуация метилирования в SARS-CoV-2 может предоставить новый механизм для дальнейшего изучения.

    Большой резервуар коронавируса летучих мышей, похожего на SARS, способен эффективно использовать человеческий рецептор ACE2 для стыковки, репликации и проникновения.27 ACE2 преимущественно экспрессируется в альвеолярных клетках человека и эпителиальных клетках кишечника. Изменение силы связывания вызвано мутацией последовательности SARS-CoV-2, которая заслуживает дальнейшего изучения. Мы обнаружили, что электростатические изменения между ZJ01 и Wuhan-Hu-1 были сильно сконцентрированы в зоне мутации S2 (части S-белка, которая способствует слиянию вируса с клетками-хозяевами). Следовательно, срочно необходимы дальнейшие исследования, изучающие механизмы, подчеркивающие эти конформации и изменения силы связывания.Это может помочь объяснить усиление симптомов со стороны желудочно-кишечного тракта на более поздней стадии вспышки вируса и их новые эпидемиологические / клинические особенности.

    Это исследование имеет несколько ограничений. Во-первых, лучше получить результаты и более подробные терапевтические ответы в когортном исследовании пациентов с COVID-19 с симптомами желудочно-кишечного тракта. Во-вторых, хотя факторы риска тяжелого / критического типа COVID-19 были определены в соответствии с данными пациента при поступлении, по-прежнему отсутствует прогностическая модель прогрессирования заболевания.В-третьих, цитокиновый шторм часто встречается при коронавирусе28, о чем сообщалось в предыдущем исследовании SARS-CoV-25; таким образом, было бы лучше, если бы мы могли также обнаруживать изменения цитокинов в этом исследовании. В-четвертых, будет иметь большее клиническое значение предложение эффективной стратегии выявления пациентов с COVID-19 с симптомами желудочно-кишечного тракта, у которых на ранней стадии отсутствуют типичные симптомы, такие как лихорадка и кашель. Согласно нашему опыту, в процессе скрининга нам следует уделять больше внимания истории воздействия и группированию семей.В-пятых, было бы целесообразно исследовать корреляцию между вирусным геномом и симптомами со стороны желудочно-кишечного тракта. Наконец, поскольку более 50% SARS-CoV-2 было обнаружено в фекалиях согласно одному исследованию 29, в будущем следует сравнивать распространенность вирусной РНК из образцов фекалий у пациентов с симптомами желудочно-кишечного тракта с таковыми у пациентов без симптомов желудочно-кишечного тракта. Более того, из-за относительно низкого уровня обнаружения вируса в кале (трое из девяти пациентов с положительным результатом на COVID-19 в нашей больнице) и редкие образцы стула были повторно протестированы на вирус у пациентов после их выздоровления в этом исследовании, это трудно оценить последствия фекально-оральной передачи, поэтому это требует дальнейшего изучения.

    Таким образом, мы впервые сообщили о самых крупных случаях пациентов с COVID-19 с симптомами желудочно-кишечного тракта за пределами Ухани и продемонстрировали его новые характеристики: повышенная группировка семей и повреждение печени, тяжелая / критическая тенденция и более высокая температура тела. > 38,5 ° С. Мировым властям следует уделять больше внимания пациентам с COVID-19 с желудочно-кишечным трактом и другими неклассическими симптомами и сохранять осторожность в защите медицинских работников.

    Тулий - информация об элементе, свойства и применение

    Расшифровка:

    Химия в ее элементе: тулий

    (Promo)

    Вы слушаете Химию в ее элементе, представленную вам Chemistry World , журналом Королевского химического общества.

    (Конец промо)

    Meera Senthilingam

    Стихия этой недели переносит нас в неизведанное, в темные, таинственные земли.

    Брайан Клегг

    В средневековье, когда карты были украшены странными и экзотическими неизвестными, где на углах могла быть начертана надпись «Вот монстры», самое далекое место, которое только можно было представить, лежащее за пределами известного world, был назван «Ultima Thule».Thule иногда произносится как Tooli, хотя похоже, что это должно быть Thool, что, честно говоря, звучит гораздо более уместно темным и загадочным. Первоначально это было классическое название таинственной земли, находящейся в шести днях плавания к северу от Британии, которую греческий историк Полибий считал самой северной частью мира. «Ultima Thule» пошла еще дальше - это была самая дальняя часть Туле.

    Когда Тулий был назван Пер Теодором Клеве в 1879 году, это произошло из-за небольшого непонимания значения слова thule.Клив в конечном итоге обнаружил в общей сложности четыре элемента и получил медаль Дэви от Королевского общества за свою работу по редкоземельным металлам, но здесь он не был полностью точен. Он писал: «О оксиде, помещенном между иттербией и эрбией. Я предлагаю название тулия, производное от Туле, древнего названия Скандинавии ». Мало того, что он потерял Туле, он даже не мог правильно написать это, поставив в названии две буквы L - но сегодня мы пишем тулий, как Туле, с одним L.

    Сидя ближе к концу лантаноидов, плавающей полоски Из элементов периодической таблицы, которые протискиваются между барием и лютецием, тулий имеет атомный номер 69.Это один из редкоземельных элементов, элементы, которые в значительной степени ошибочно называют, поскольку они довольно распространены. Название отражает редкость исходной руды, в которой они были обнаружены, но в случае тулия это не такое уж плохое название, поскольку этот мягкий серебристый металл является одним из самых редких из редкоземельных металлов и более ценен, чем платина.

    Первоначальное открытие элемента произошло случайно. Следы эрбия и тербия были обнаружены при первом открытии итрия, хотя изначально не предполагалось, что они являются новыми элементами сами по себе.Клив исследовал оксид эрбия, выделенный из смеси, и обнаружил, что он тоже был поврежден. В нем было небольшое количество неизвестного вещества, которое немного изменяло атомный вес. Более тонкое разделение содержимого этой продуктивной руды в конечном итоге приведет к образованию оксидов еще двух элементов - гольмия и, наконец, тулия.

    Тулий долгое время был веществом Золушки. С тулием нельзя было сделать ничего лучше и дешевле с одним из других элементов.Было похоже, что его отправят на помойку бесполезных химических веществ. Примечательно, что один научный писатель сказал о тулии: «Самое удивительное в нем то, что в нем нет ничего удивительного». Но это немного несправедливо.

    Тулий не совсем массовый рынок, но около 50 тонн его добывается каждый год в трех группах руд - Австралии и Китае, США и Бразилии, Индии и Шри-Ланке. И это не зря потраченное усилие.

    Единственный природный изотоп тулия, обычно встречающийся в виде оксида, - это тулий 169. Он стабилен, но тулий 170 с периодом полураспада 128 дней, полученный бомбардировкой тулия в ядерном реакторе, оказался хорошим портативным источником x -лучей. Впервые он был предложен для этой роли в 1950-х годах и с тех пор часто использовался в небольших устройствах, таких как те, которые используются в стоматологических кабинетах. Как источник с низким энергопотреблением, он относительно безопасен, что делает его хорошим выбором для низкотехнологичных приложений, которые также используются в инженерии, где рентгеновские лучи можно использовать для поиска трещин в компонентах.

    Менее распространенной, но все же важной является роль тулия в легировании особого типа граната, иттрий-алюминиевого граната или YAG. Кристалл используется в качестве активной среды в лазере с длиной волны около 2000 нанометров, который идеально подходит для лазерной хирургии, поэтому тулий снова приходит к нам в медицинскую помощь.

    Тулий, возможно, не имеет широкого применения, но он внес свой вклад в Нобелевскую премию американского химика Теодора Уильяма Ричардса. Если когда-либо и присуждалась Нобелевская премия за упорный и упорный труд, то это была премия Ричардса в 1914 году.Цитирование Нобелевской премии должно быть одним из наименее захватывающих из когда-либо сделанных. Это было «в знак признания его точного определения атомного веса большого числа химических элементов». Но для одного только тулия это отражает в общей сложности 15 000 экспериментов по перекристаллизации, прежде чем Ричардс получил достаточно чистый образец бромата тулия, чтобы можно было определить его атомный вес к своему удовлетворению (168,93421, если быть точным).

    Когда Пер Теодор Клев назвал тулий, он работал в Упсальском университете в Швеции, старейшем из университетов Северной Европы.Он хотел прославить историческую скандинавскую культуру - и даже если он не совсем правильно позиционировал мифологическую страну, для Клива его новым открытием останется Ultima Thule.

    Meera Senthilingam

    Переносит нас в далекие страны с помощью элемента, который приходит в нашу медицинскую помощь в виде лазеров и небольших рентгеновских лучей. Это был научный писатель Брайан Клегг с химией тулия. Теперь, на следующей неделе, элемент, которым можно управлять, чтобы получить то, что мы хотим.

    Andrea Sella

    Темно-серого цвета и с очень глянцевым стеклянным блеском, он выглядит как металл, но на самом деле является довольно плохим проводником электричества, и во многих отношениях кроется секрет его окончательного успех. Преднамеренно вводя примеси, такие как бор или фосфор, можно незаметно изменить электрическое поведение элемента. Такие уловки лежат в основе функционирования кремниевых чипов, которые позволяют вам слушать этот подкаст. Менее чем за 50 лет кремний превратился из любопытного любопытства в один из важнейших элементов нашей жизни.

    Meera Senthilingam

    А чтобы узнать больше о том, насколько важен кремний в нашей повседневной жизни, присоединяйтесь к Андреа Селла в презентации «Химия в ее стихии» на следующей неделе. А пока я Мира Сентилингам, и спасибо за внимание.

    (промо)

    (конец промо)

    падает с фасада, Текаши 69 - это всего лишь Даниэль Эрнандес в суде

    [Обновление: Текаши 69, на третий день дачи показаний, обвинил рэпера Джима Джонса в принадлежности к банде Девяти Треев.]

    На протяжении всей своей краткой стремительной карьеры рэпер, известный как Tekashi 69 (или 6ix9ine), изображал из себя упрямого гадена, намеревающегося разжигать конфликт ради самого конфликта. Он травил правоохранительные органы в социальных сетях оружием и деньгами. Он вел прямую трансляцию в постели с подругами других рэперов.

    Но в среду в зале федерального суда на Манхэттене личность 6ix9ine исчезла. Его место занял внимательный, сердечный Даниэль Эрнандес, доктор Джекилл из 6ix9ine's Mr.Гайд. Он был там с целью, которую его альтер-эго, вероятно, никогда не предвидело: дать показания против своей бывшей команды, Девяти Кровавых гангстеров Трея.

    Перед судом находятся двое бывших доверенных лиц г-на Эрнандеса, в том числе Энтони Эллисон, предполагаемый высокопоставленный член банды «Девять Треев», который когда-то служил телохранителем г-на Эрнандеса.

    Поворот г-на Эрнандеса в качестве главного свидетеля федерального правительства - потрясающий поворот в его карьере. В среду звезда Instagram часами сидела на трибуне и подробно рассказывала о внутренней работе заведомо замкнутой банды Девяти Трей.

    Контраст между шумным рэпером в социальных сетях и человеком на стенде был разительным. Г-н Эрнандес был расслаблен, иногда опираясь на трибуну судьи, проводя присяжных по жизни банды.

    По его словам, в 2017 году он обнял Nine Trey после того, как банда помогла продвинуть его многократный прорывный сингл «GUMMO». Музыкальное видео на этот трек, в котором участвовали участники Nine Trey, мгновенно стало вирусным.

    «Я знал, что формула состоит в том, чтобы повторить это», - сказал г-н.- сказал Эрнандес. «Имидж банды, как его продвигать».

    Он подробно обрисовал иерархию Девяти Трей в суде, перечислив ее лидеров поименно. Он часто останавливался, чтобы переводить уличный сленг для присяжных, и подробно описал несколько нападений банды, в том числе один случай, когда они преследовали и напали на другого рэпера, Триппи Редда.

    В какой-то момент г-н Эрнандес перечислил принадлежность к бандам других рэперов.

    Несколько раз г-н Эрнандес имитировал голоса Девяти членов Трея и разыгрывал разговоры, которые он ранее вел с ними.Он пустился в неожиданные отступления, настолько конкретные - например, его выбор куртки во время одного эпизода с бандой, - что прокуратуре пришлось переориентировать его.

    Его решимость, казалось, ненадолго пошатнулась, когда он рассказал о своем предполагаемом похищении в июле прошлого года г-ном Эллисоном, инцидент, который, по словам г-на Эрнандеса, произошел из-за распрей внутри Nine Trey по поводу того, кто в иерархии банды будет контролировать его музыкальную карьеру.

    «У меня в голове крутились безумные мысли», - сказал он в среду, его голос стал тише, когда он описал, как его держали в заложниках в машине в Бруклине.

    Инцидент, получивший широкую огласку в то время, стал началом разрыва отношений г-на Эрнандеса и Девяти Трея.

    «Я устал от вымогательства», - сказал он в среду.

    Четыре месяца спустя г-н Эрнандес публично отказался от своего бывшего менеджера, Кифано Джордана, г-на Эллисона и банды Девяти Трей. Несколько дней спустя сотрудники правоохранительных органов арестовали их и множество других, подозреваемых в принадлежности к Девяти Треям.

    В течение 24 часов г-н Эрнандес заключил сделку с прокурорами, которые в обмен на его сотрудничество согласились лоббировать у судьи смягчение приговора.

    Судебный процесс в среду - это часть масштабного дела о рэкете и огнестрельном оружии, которое прокуратура возбудила против банды Девяти Трей в ноябре прошлого года.

    Показания г-на Эрнандеса открыли редкую возможность увидеть пересечение уличных банд и рэпа, двух общеизвестно охраняемых миров, которые почти открыто отреклись от г-на Эрнандеса в самый разгар его переосмысления.

    В среду рэпер Мик Милл написал в Твиттере, что г-н Эрнандес был «интернет-гангстером». Рэпер Снуп Догг назвал его «крысой».

    Сможет ли г-н Эрнандес спасти что-нибудь из 6ix9ine, мятежного персонажа, которого он создал, остается неясным.

    Ранее прокуратура заявляла, что ему, возможно, потребуется участие в программе защиты свидетелей. Его адвокат утверждал, что персонаж 6ix9ine был актом, и что его объятия бандой жизни были предназначены только для поддержки его карьеры.

    В суде на этой неделе г-на Эрнандеса попросили расшифровать, казалось, угрожающие слова из «GUMMO», направленные против Триппи Редда, его соперника.

    «Это песня, посвященная кому-то, с кем я не ладил», - сказал он. "Я не знаю. В то время я думал, что это было круто ».

    Определение Monero

    Что такое Monero?

    Monero - это цифровая валюта, которая обеспечивает высокий уровень анонимности для пользователей и их транзакций. Как и Биткойн, Monero является децентрализованной одноранговой криптовалютой, но в отличие от Биткойна, Monero характеризуется как более анонимная или ориентированная на конфиденциальность цифровая наличность.

    Ключевые выводы

    • Monero - популярная криптовалюта, основанная на блокчейне, или альткойн.
    • У
    • Monero есть несколько улучшающих конфиденциальность функций, которые улучшают биткойн.
    • Как и Биткойн, Monero имеет открытый исходный код и создается на основе децентрализованной разработки на низовом уровне.

    Понимание Monero

    Monero был создан как массовое движение без предварительного майнинга и без венчурного финансирования и запущен в апреле 2014 года как форк Bytecoin. Форк происходит, когда исходная криптовалюта разделяется на две части для создания другой версии, что становится возможным благодаря форматам с открытым исходным кодом, преобладающим в большинстве конструкций криптовалюты.Большинство вилок сформировано для устранения недостатков материнской валюты и создания лучших альтернатив.

    Популярность Monero в криптовалютном мире растет в основном из-за его анонимности. Всем пользователям криптовалюты предоставляется общедоступный адрес или ключ, уникальный для каждого пользователя. С биткойнами получатель монет переводит монеты на свой адрес, который он должен сообщить отправителю. Отправитель может увидеть, сколько биткойнов есть у получателя, если он узнает публичный адрес получателя средств.Через блокчейн Биткойн все монеты, переданные от отправителя получателю, записываются и публикуются.

    Однако транзакции с Monero не дают отправителю окна просмотра авуаров получателя, даже если отправитель знает публичный адрес получателя. Транзакции Monero не связаны и не отслеживаются. Монеты, отправленные получателю, перенаправляются через адрес, который создается случайным образом для использования специально для этой транзакции.

    В реестре Monero, в отличие от блокчейна, не записываются фактические скрытые адреса отправителя и получателя, а записываемый одноразовый адрес не связан с фактическим адресом какой-либо из сторон.Следовательно, любой, кто исследует непрозрачную бухгалтерскую книгу Monero, не сможет отследить адреса и лиц, участвовавших в какой-либо прошлой или нынешней транзакции.

    Особенности Monero

    Monero также имеет функцию, называемую кольцевой подписью, которая скрывает источники средств, так что их практически невозможно отследить для сторон, участвующих в переводе. Кольцевая подпись гарантирует, что каждая транзакция Monero между двумя сторонами группируется с другими множественными транзакциями, которые происходят между другими несвязанными сторонами.

    Это означает, что средства получателя смешиваются с транзакциями других пользователей Monero и случайным образом перемещаются по списку транзакций, что значительно затрудняет отслеживание источника или получателя. Кольцевая подпись также расшифровывает фактическую сумму, вовлеченную в любую транзакцию. Обратите внимание, что кольцевая подпись отличается от техники смешивания и анонимизации при совместном соединении, принятой другими криптовалютами, борющимися за анонимность.

    Наконец, Monero имеет особый способ обработки транзакций, разделяя сумму, передаваемую на несколько сумм, и обрабатывая каждую разделенную сумму как отдельную транзакцию.Например, у пользователя, который переводит 200 XMR (денежная единица Monero) покупателю, сумма будет разделена, скажем, на 83 XMR, 69 XMR и 48 XMR, на общую сумму 200 XMR.

    Каждый из них обрабатывается отдельно, и для каждой из разделенных фигур создается уникальный одноразовый адрес. При использовании кольцевой подписи каждая из этих разделенных сумм смешивается с другими транзакциями, которые, конечно же, также были разделены, что чрезвычайно затрудняет определение точного сочетания 200 XMR, принадлежащих получателю.

    Символ валюты для Monero - XMR, а Monero во множественном числе - Moneroj.

    Monero, конфиденциальность и популярность

    Monero обеспечивает прозрачность, основанную на усмотрении пользователей. У всех пользователей есть «ключ просмотра», который можно использовать для доступа к учетной записи с соответствующим закрытым ключом. Пользователь может предоставить свой ключ просмотра выбранным сторонам с установленными ограничениями, такими как доступ к просмотру авуаров учетной записи, но без возможности тратить какие-либо средства, хранящиеся на счете; доступ ко всем историческим и текущим транзакциям; или доступ только к определенным транзакциям в учетной записи.К выбранным сторонам относятся родители, которым могут потребоваться ключи просмотра для отслеживания транзакций своих детей, и аудиторы, которым пользователь хотел бы предоставить доступ для аудита средств и стоимости своего аккаунта.

    В дополнение к ключу просмотра у пользователей также есть «ключ расходов», который разрешает выбранному объекту, с которым пользователь делится ключом, тратить или переводить средства со счета. Как и клавиша просмотра, клавиша траты имеет длину 64 символа и состоит из букв и цифр.

    Популярность Monero выросла не только из-за намерения участвовать в незаконной деятельности на подпольном рынке, но и среди людей, которые просто хотят иметь возможность приобретать товары и услуги в Интернете анонимно.Лица, которые не хотят получать нежелательную рекламу, основанную на их привычках к расходам, от интернет-маркетологов, состоятельные люди, которые часто становятся жертвами киберпреступников, люди, покупающие секс-игрушки, и больные, которые предпочитают покупать свои наркотики анонимно в Интернете, - вот несколько примеров пользователей, предпочел бы уникальную платформу конфиденциальности Monero прозрачной бухгалтерской книге Биткойна.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *